4 Lesson 8 worksheets PDF

Title 4 Lesson 8 worksheets
Course Statics
Institution Jahangirnagar University
Pages 14
File Size 345.1 KB
File Type PDF
Total Downloads 102
Total Views 164

Summary

Download 4 Lesson 8 worksheets PDF


Description

Lesson 8 DNA Fingerprinting Pre-Lesson Reading: 1.

What is cell? a. b. c.

2.

Cells are the basic building blocks of all living things. Human body is composed of trillions of cells. Cells provide structure for a body, take in nutrients from food, convert nutrients into energy, and carry out specialised functions.

What is DNA? a.

In a cell, DNA (deoxyribonucleic acid) molecules are packaged in chromosomes within the nucleus.

b.

In a human body cell, there are 23 pairs of chromosomes.

c.

DNA (deoxyribonucleic acid) is a large, polymeric molecule. A gene is a segment of DNA molecule of a chromosome. It is the basic unit of heredity. Genes determine the body characteristics of an organism. Each inherited characteristic is controlled by one or several genes.

d.

DNA (deoxyribonucleic acid) is found in nearly every cell in the body. One significant exception is red blood cells (lack nuclei).

e.

Nearly every cell in a person’s body has the same DNA.

f.

As shown in Figure 1, DNA looks like an incredibly long twisted ladder. This shape is called a double helix. The sides of the ladder are a linked chain of alternating sugar and phosphate molecules (called the backbone). The rungs connected to the sugar molecules are known as bases.

1

Figure 1 A representation of DNA model g.

The DNA backbone is exactly the same in all people. On the other hand, the rungs are different in people.

h.

Each rung is made up of two bases that link together. There are four bases adenine (A), thymine (T), guanine (G) and cytosine (C). Because of their chemical nature, A will only link with T and G will only link with C (i.e. AT; G-C). No base can join with itself (i.e. No A-A / T-T / G-G / C-C).

i.

The order of the bases of DNA determines the information available for building and maintaining an organism. This order is referred to as genetic code.

j.

Human DNA consists of about 3 billion bases, and more than 99 % of the base sequence in DNA is the same in all people. Less than 1 % is unique to each individual (except identical twins).

2

Lesson 8

DNA Fingerprinting

Worksheet 8.1 1.

What is DNA?

Decide whether the following statements are TRUE or FALSE. a. b. c. d. e.

There are 46 pairs of chromosomes in the cell nucleus. Chromosomes are made of DNA and proteins. DNA determines the body characteristics of an organism. DNA is extracted from red blood cells found in a blood sample. The hair and teeth of the same person are composed of same DNA

f. g.

molecules. Identical twins have different base sequences of DNA. In the DNA structure, adenine (A) will only link with cytosine (C) and guanine (G) will only link with thymine (T).

Answers: a. b. c. d. e. f. g. 2.

If the sequence on one strand of DNA is: GATCCTCATA What is the sequence on the other strand?

Answers:

3

Lesson 8

DNA Fingerprinting

Worksheet 8.2

DNA Extraction from strawberries

Objective of experiment: To extract DNA from strawberries with a washing-up liquid Apparatus and Materials (per group): mortar x 1 pestle x 1 beaker x 1 test tube x 1 muslin cloth funnel x 1 glass rod x 1 toothpick x 1 strawberry x 2 salt (1/2 teaspoon) ice-cold alcohol (about 10mL) washing-up liquid (about 10mL) tap water (about 30mL) ice Procedures: 1.

Grind strawberries with a pestle in the mortar.

2.

Add about 10 mL washing-up liquid, 1/2 teaspoon salt and approximately 30 mL

3.

tap water to the grinded strawberries. Stir the mixture gently for 1 minute. Filter the mixture through a muslin cloth into a test tube, about 1/3 full, to separate strawberries from the clear liquid.

4.

Double up the volume of the mixture by adding alcohol slowly into the test tube.

5.

Leave the mixture undisturbed for 2-3 minutes in an ice-bath until no emergence

6.

of bubbles. Swirl a toothpick around the interface of the two layers formed inside the test tube. Long and stringy threads can be picked up.

4

Discussions: 1.

Can we extract DNA from other plants, say, onion, kiwi fruit, broccoli, banana (without skin) with the same method? Why?

2.

At a crime scene what forensic evidence can you collect for the extraction of DNA?

Questions: 1.

What is the purpose of grinding the strawberries?

2.

Where is the DNA of strawberries?

3.

What is the function of the washing-up liquid (detergent) in step 2?

4.

What is the function of salt in step 2?

5.

What happens when alcohol is added to the solution in step 4?

5

Lesson 8

DNA Fingerprinting

Worksheet 8.3

Location and Sources of DNA at Crime Scene

Guess (i) the possible locations of DNA on the collected evidence from a crime scene and (ii) the possible sources of DNA. Evidence

Possible locations of

Possible sources of DNA

DNA on the collected evidence Eyeglasses Baseball bat

Ear pieces

Sweat, skin

Facial tissue

Dirty laundry Used cigarette Bottle, can, glass Blanket, pillow, sheet

Bite mark Fingernail, partial fingernail

6

Lesson 8

DNA Fingerprinting

Worksheet 8.4

1.

Restriction Enzymes

Restriction enzyme, EcoRI always cuts DNA at GAATTC as indicated below:

 GAATTC CTTAAG 

You are provided with the following DNA sample. GTAAGAATTCTTTAGAATTCCGCCATTATCGAATTCAGGATCTTAC CATTCTTAAGAAATCTTAAGGCGGTAATAGCTTAAGTCCTAGAATG

2.

a.

How many times does the specified base sequence GAATTC appear?

b.

How many fragments would result from a restriction digestion of the DNA

c.

sample with the enzyme EcoRI? List all the fragments formed.

Different restriction enzymes cut at different sites, two examples are listed below: Enzyme HaeIII

Cutting Site GGCC

Bam HI

GGATCC

 GGCC CCGG 

 GGATCC CCTAAGG

Now, you are provided with the following DNA sample:  GTAGGATCCACGGAAGCT TGCAGGCCGCGAATTCAGGCCATA CATCCTAGGTGCCT TCGAACGTCCGGCGCT TAAGTCCGGTAT For each restriction enzyme, a. How many times does cutting site appear? b. How many fragments would result from a restriction digestion of the DNA c.

sample with the enzyme? List all the fragments formed.

7

Answers:

8

Lesson 8

DNA Fingerprinting

Worksheet 8.5 1.

DNA fingerprint Analysis

A child inherits one set of chromosomes from each parent. This is why children carry characteristics from both of their parents. A child who has mom with brown hair and blue eyes and dad with blond hair and brown eyes might end up with brown hair from his mom and brown eyes from his dad. The Chan’s family consists of mom, dad and four kids. The parents have one daughter and one son together, the other daughter is from the mother’s previous marriage, and the other son is adopted. Here are the DNA analysis results:

Answer the following questions: a. Which child is adopted? b. Which child is from the mother’s previous marriage? c. Who are the own children of Mr and Mrs Chan? In all cases, make use of DNA profile to explain your answers briefly.

9

2.

There was a murder case. A blood sample from a crime scene was collected. DNA samples of the victim and the potential suspects (June, Scarlet and John) were collected for DNA analysis. The DNA profile is shown below. Now, you should be able to identify the potential murderer.

10

Answers: 1.

2.

11

Extended discussion: 1.

2.

12

Lesson 8

DNA Fingerprinting

Worksheet 8.6

Group discussion

1. Do white blood cells give more accurate test result for paternity than cheek cells? 2. What are the legal and ethical issues on the use of DNA fingerprinting in society? 3. DNA fingerprinting can be used to convict someone of a crime. What would be the difficulty in using this technique to identify criminals if the suspects were father and son? Twin brothers? 4. Other than forensic science, list out the other uses of DNA analysis. Describe each use briefly.

13

Lesson 8

DNA Fingerprinting

Follow-up Activity Extended Reading– O. J. Simpson murder case 1. Download the article (O. J. Simpson murder case ) from the following websites: a.

O. J. Simpson Trial Homepage, http://www.law.umkc.edu/faculty/projects/ftrials/Simpson/simpson.htm

b. http://phobos.ramapo.edu/~jweiss/laws131/unit3/simpson.htm 2. Read the article and answer the following questions: a.

“If you are the lawyer of the defendant, what type of questions you would

b.

focus to challenge the DNA evidence provided by the prosecutor? Why?” Is it possible for criminals to erase traces of DNA evidence? Explain your

c.

answers? May refer to O. J. Simpson murder case to ask students more questions on the use of DNA evidence in court case.

14...


Similar Free PDFs