Bacterial Genetics - Lecture notes 1 PDF

Preview

Summary

Professor sträube...

Description

BACTERIAL GENETICS 03/05/19  Most early work in molecular biology was done in prokaryotes o Haploid o No introns o Very large populations o Short generation times o Easy extraction o Conjugation and transformation  Function of DNA o Carry info, especially the primary structure of proteins o This info is enclosed inn the base sequence of the DNA molecules o DNA is a polyer  Monomers of DNA are nucleotides  Nucleotides are made of three kinds of molecules o DNA replication  During division, each cell must rapidly copy all of its DNA  Each human cell nucleus contains about 3 billion DNA bases  Any copy mistakes are mutations and can be fatal Protein synthesis  Making a protein o The primary structure of a protein is stored in genes o The info is moved from the DNA to the ribosomes as mRNA o DNA sense strand serves as a template for the synthesis of a molecules of RNA o This process is transcription  RNA polymerase binds to promoter region of the gene  If the operator region is not occupied, the polymerase opens a local portion of the DNA helix  Using the standard bas paring the polymerase makes a copy of the DNA strand as mRNA  DNA vs RNA o All cells contain two kinds of nucleic acids o Both kinds participate in protein synthesis o RNA is single stranded o Functions  DNA: master code; safe guarded in the cell’s nucleus  tRNA: (transfer RNA) transfers amino acids to the ribosomes  mRNA: (message RNA) moves the plans from the nucles to the ribosome  rRNA: (ribosomal RNA) with protein, makes the ribosome structure



   





Prokaryotic vs Eukaryotic organization o Eukaryotic genes have introns:DNA sequence that does not code for the protein o Full length transcipts are made (mRNA) o mRNA must be edited before its translated o No introns in prokaryotes o Once the full length mRNA has been transcribed, it has to be edited to produce a mature message mRNA carries the plans for the amino acid sequene as 3 base clusters called CODONS The plans for the protein are now on mRNA and moving to the cytoplasm Another kind of RNA required for protein synthesis is tRNA which will withdraw an amino acid from the cellular pool and deliver it to the gorwing peptide chain Translation o mRNA moves out of the nucleus into the cytoplasm o Message is edited to remove introns o Ribosomal subunits attach to the mRNA o mRNA directs placement of amino acids via a three base code: codons Mutation o A mutation is a random change in DNA base sequence o Mutation can be as small as an alteration of a single base o If the DNA in a gene is altered, the mRNA transcribed from that gene will also be altered Phenotypic variation o May be the result of genetic changes o May be due to environmental factors

QUIZ Culturing Transcription Translation

03/07/19 PROJECT Disease Symptoms Organism What can happen if you have disease? Bacterial or viral Interesting facts about bacteria or viral cell Does organism cause disease? How does it cause disease? 15 minutes but no more than 20 minutes Treatment Research Paper on topic CONT. LECTURE

GCTACCTATATTTTATTGGC mRNA: CGAUGGAUAUAAAAUAACG ( change g to c.. c to g.. t Dna:

to a.. a to u ) polypepide: methionine 





aspartic acid isoleucine lysine

Phenotypic variation o May be the result of genetic changes  Changes from prototroph to auxotroph o May be due to environment factors Types o Point o Frameshift o Insertion/inversion/deletion Point mutation o Single base change

DNA mRNA ACA ACG

UGU UGC

Amino Acid Cys Cys

ACC

UGG

Trp

ACT

UGA

Stop







Mutation type

Silent (Changed DNA produces a ‘synonym for the orginal codon) (No change in peptide’s primary structure—no change in function Missense (Changed DNA produces a mRNS codon for a different amino acid, primary structure of peptide is changed this may have no affect, reduce peptide function, improve function (rare)) Nonsense (Changed DNA now contains a premature STOP condon) (Peptide is truncated—peptide is almost always non functional)

Sickle cell disease o Sickle cell is a genetic disease in which hemoglobin molecules don’t form correctly o Hemoglobin is a large molecule in red blood cells that carried O2 and CO2 o Hemoglobin has a quaternary structure o Cause by a single DNA base change at one end of the B chain o Normal blood cells are very flexible and sickle cells are very stiff Frame shift o One or more bases are inseted or deleted o All of the codons down streak from the mutation site can be altered Causes of mutations o Spontaneous  No identifiable agent  Due to base mispairing? o Induced mutation  Identifiable agent  Examples  Mutagens— o Radiation: UV causes adjacent pyrimidines to dimerize and ionizing radiation produces free radicals that break the chain o Chemicals: base analogs, methylating agents, amino group removing agents cause adenine to pair with cytosine. Acrdine derivatives

DNA repair o Photoactivated  Break bonds between dimerized bases o Dark repair  Endonuclease breaks defective strand  DNA polymerase synthesize a replacement strand  Exonuclease removes damaged strand  Ligase seals gap  -REGULATION OF GENE EXPPRESSION  The expression of genes for some enzymes is not controlled—constitutive genes o They are express regardless of substrate availability  Other genes are expressed (turned on) only under certain conditions—inducible genes  Other genes are turned off under certain conditions—repressible genes  Operon: a groups of closely related genes o Contains structural genes for making the enzyme and genes for proteins required to make the enzyme function, plus regulatory sites for controlling production of the enzyme  The genes coding for these proteins are organized in a cluster or OPERON o Another important gene is lacI which codes for the regulator protein and is located upstream from the Lac operon 

TEST Chemotaxes through Tuesday 4 TYPES OF FLAGELLA…… TUESDAY INFO 03/12/19 LECTURE NOTES  In order to utlize lactose, a bacteriam must o Synthesize a transport protein to get the disaccharide into the cell o Synthesize an enymer, B Glactosidase, which hydrolyzes the disaccharide into glucose and galactose, and which also produce an altered form of lactose called allolactose  If lactose is not present in the media, there is no reason for the bacterium to make these proteins. The operon gets ‘turned off’ in the absence of lactose o If present, the operon must be ’turned on’  Catabolite repression o There is another layer of control of expression of the Lac operon o Glucose utilizing genes are expressed constitutively o If both glucose and lactose are present in the medium, the bacterium will use the glucose first. The lac operon will be repressed even though lactose is available o When glucose is depleted, the Lac operon is depressed





When high levels of glucose are present in a cell, the amount of a signal molecule, cAMP, is low. o Inhibits the formation of cAMP-CAP complex that promotes RNA polymerase-DNA binding. o Operon is not efficienty transcribed When glucose levels in cell are low, cAMP levels rise and the formation of the cAMP-CAP complex is more likely



FOR TEST-DON’T WORRY ABOUT ENZYME—LOOK AT SUMMARY SLDE TWO PARTS OF PHOTOSYNTHESIS Briefly describe how lactose affects he cAMP-CAP Types of media—selective, complex, differential Biofilms- conscenseing?...