Genetics Final Exam Practice PDF

Preview

Summary

Relevant exam practice questions separated by exam. question material was found on true exams...

Description

Exam Questions Exam 1 Topics 1. Who proved DNA was the transforming factor a. Avery, Macleod, McCarty b. Hershey and Chase c. Griffith d. Chargaf 2. Sia and Dawson proved a. Mice were important to the transforming agent b. IIS and IIR virus could be transformed using DNA c. Showed mice were not important to the transforming principal d. Prokaryotes have the ori C. site 3. What is false about the structure of DNA a. Its antiparallel b. Its twists are 3.4 A c. Structure of DNA disproved Chargaf’s rule d. A form is the physiological form e. Two of the above 4. What is the complementary sequence for the RNA strans 3’-UGAUUTAC-5’ 5. What is the function of Tao in DNA Polymerase III a. Proofreading b. Catalyzation c. Dimerization d. Keep the enzyme on 6. What places positive super coils into DNA a. Topoisomerase 1 b. Topoisomerase 2 c. DNA Polymerase 1 d. Helicase 7. How many proteins are in a chromatosome a. 8 b. 9 c. 7 d. 5 8. Which is false regarding Chargaf’s rule a. A=T b. C=G c. A+T=C+G d. A+G=C+T 9. If a DNA strand is composed of 14% Guanine, what percent is Adenine a. 14% b. 36% c. 72%

d. 24% 10. Which would be least deleterious a. Single base insert before 5th codon b. TTA to TGA in 5’ UTR c. Changed 3rd base of second codon d. Changed 1st base of third codon 11. What type of mutation has no efect on the phenotype? a. Suppressor mutation b. Back-Mutation c. Wild-Type Mutation 12. There are 6 codons for Leucine, what is the minimal # of tRNA based on the Wobble hypothesis a. 4 b. 6 c. 2 d. 3 13. Image below shows regions of a bacteria, region B start from base 157 and ends at base 210, what region is labeled C

A

14.

15.

16.

17.

B

C

a. 3’ UTR b. 5’UTR c. CDS d. Stop Codon What is the first base of the TSS region from image above? a. A b. G c. Either purine d. Either pyridine What is a possible second base of the last codon in region C a. A b. C c. U d. Not enough information What is the length of the CDS region? a. 15 codons b. 18 codons c. 22 codons d. 12 codons How many GTPs would it take to make the protein a. 36 b. 40

18.

19.

20.

21.

22.

23.

24.

25.

c. 34 d. 32 How many introns are in the sequence? a. 0 b. 1 c. 3 d. Not enough information How many amino acids are there in this bacterial sequence AUGUAAGUACGGACUACUGAUGGACUACAGGAGGUGCACGAUGUUAGAUAUGUCAGGA a. 4 b. 6 c. 9 d. 12 Which base will not be mutating by deamination a. A b. G c. C d. They all will Which does not need a primer? a. DNA polymerase 1 b. DNA polymerase 3 c. DNA polymerase 2 d. RNA Polymerase Acridines, like ethydiumbromide, cause what type of mutation\ a. Silence Mutation b. Frameshift Mutation c. Deamination d. Base Analog Mutation Which one does not cause a bidirectional transition a. Base Analog b. Acridines c. Deamination d. Hydroxylation e. False, they all cause bidirectional transitions Who determined that replication was bi-directional? a. Schonos and Inman b. Cairns c. Kornburg d. Tayor/Woods/Hughs What did the Bruce Ames Test determined a. Filler answer b. Potential carcinogens in eukaryotes need to be modified before they are mutagenic c. Potential carcinogens in prokaryotes need to be modified before they are mutagenic d. Filler answer

26. If 7 amino acids need to be translate, how many GTPs would it take a. 7 b. 9 c. 14 d. 12 27. Which are true about DNA Polymerase I a. It is the main replicating polymerase in bacteria b. It has 5’ to 3’ exonuclease c. 3’ to 5’ exonuclease d. Answers b and c e. All of the above 28. Which DNA repair removes large T dimers a. BER b. NER c. Light dependent repair d. Mismatch repair 29. NER excision repair is initiated by a. Mut H b. Mut S c. UvR C d. UvR A 30. Which DNA repair method provides back up to proof-reading a. Mismatch Repair b. Excision Repair c. Light Dependent Repair d. Post-replication repair 31. What is true about Mismatch repair a. Uses Mut H, Mut L, and Mut S b. Requires an exonuclease c. Cuts only the non-methylated strand with a helicase d. All of the above 32. What is the -10 sequence involved in prokaryotic transcription a. TTGACA b. TATAAT c. TATAAA d. TACTAC 33. Which contains an intron splice site a. Look for GT….TACTAC…….AG 34. What is true about Rho-dependent a. Uses a G:C region to knock RNA of b. G:C region followed by UUU region c. When Rho catches RNA polymerase it pulls it of d. Two of the above 35. What transcribes tRNAs

36.

37.

38.

39.

40.

a. RNA polymerase I b. RNA polymerase II c. RNA polymerase III d. Two of the above Which prokaryotic RNA polymerase subunit initiates transcription by recognizing the promoter a. β b. β’ c. α d. θ e. σ Which subunit of polymerase III keeps the enzyme on the DNA a. β b. Σ c. α d. ε Which general transcription factor has TBP a. TFIIA b. TFIIB c. TFIIE d. TFIID Which transcription factor orients the polymerase and shows the transcription start site a. TFIIA b. TFIIB c. TFIIE d. TFIID Which DNA repair is initiated by glycosylases a. NER b. Light Dependent c. BER d. Mismatch

41. How may exons are present based on the image above a. 4 b. 5 c. 6 d. 10 42. Which require replication to be mutagenic a. Base analog b. Deamination c. Hydroxylation d. All of the above 43. Which is unique to Eukaryotic chromosome replication

a. Replication is restricted to the S phase b. There are many polymerases functioning at the replication fork c. There are many replicons per chromosome d. mRNA is processed e. All of the above 44. Which protein structure is a combination of multimeric amino acids a. Primary b. Secondary c. Tertiary d. Quaternary 45. What is true about telomerase a. It extends the 3’ lagging end b. Uses a built in DNA template c. Prevents the ends of DNA from getting shorter d. Two of the above e. All of the above 46. 5 bromouracil produces transitions by binding to a. A b. G c. C d. Two of the above e. All of the above

47. a. Know amino acid carboxyl end binds to 3’ end of anti-codon

Exam 2 Topics 1. When an inversion occurs in a chromosome and the centromere appears to have moved this is considered a. Pericentric inversion b. Paracentric inversion c. Two of the above d. None of above 2. True or false meiosis anaphase II is similar to mitosis I

3. Which is false about the human karyotype a. There are 46 chromosomes b. There 22 autosomes c. There are 23 homologues of similar but not identical DNA d. Two of above e. All are correct 4. During mitosis, homologues line up along the metaphyseal plate during a. Anaphase I b. Anaphase II c. Metaphase d. None of these, mitosis does not have homologues 5. Assign what stage of mitosis these events occur: a. Chromosomes decondense-prophase b. Nuclear membrane disappears-prophase c. Centromeres are split-anaphase d. Attachment of microtubules to kinetochore-metaphase e. Formation of the mitotic spindle-prophase f. cell growth and replication-interphase 6. In this cross, the small plants are recessive. If a dwarf plant is crossed with a tall plant in the parent generation, what percent of the F1 population is tall? a. 75% b. 100% c. 25% d. More information needed 7. Which is not a way sex is determined a. Haploid vs. Diploid b. Presence of a Y chromosome c. Number of Barr bodies d. Ratio of X autosomes 8. What is an example of expressivity a. Polydactyl b. Pink flower petals c. Lobe eyes in flies d. Rooster combs 9. What is an example of incomplete dominance a. Polydactyl b. Pink flower petals c. Lobe eyes in flies d. Rooster combs 10. What is the maximum about of phenotypes you can get from a cross of AB/M and A/MN blood types a. 5 b. 4 c. 6

d. 12 11. Males showing sex-linked traits are due to the fact they are a. Haploid b. Hemizygous c. Recessive d. Heterozygous 12. If a person is XY and has malfunctioning TDF region they would be considered a. Phenotypically male, infertile b. Phenotypically female, infertile c. Phenotypically male, fertile d. Phenotypically female, fertile 13. True or False: An XY person with a mutated copy of the SRY region would be considered male 14. What type of dominance is denoted with superscripts a. Codominance b. Incomplete dominance c. Allelism d. Two of the above 15. Alloploidy is when a. Mitosis with no cytokinesis occurs b. Meiosis produces unreduced gamets c. Chromosomes from diferent species don’t interfere d. Two of the above 16. The ploidy that has an extra chromosome and is commonly seen in plants with no efect to them is a. Polyploidy b. Euploidy c. Alloploidy d. Autoploidy 17. Which is not an example of a hyperploid X a. Klinefelter b. Turner c. Triplo-X d. Two of the above 18. How many Barr Bodies are present in XXXY a. 1 b. 2 c. 3 d. 0 19. A woman with type AB blood and normal color vision marries a type O, color blind man. The woman’s father was color blind. What are the genotypes of the couple a. X+Xi & IAIB, XiY & ii b. X+Yi & IAIB, XiX+ & ii c. X+Xi & IAi, XiY & ii d. XiXi & IAIB, XiY & ii

20. What is the probability their child is colorblind and type A? a. ½ b. ¼ c. ¾ d. 0 21. What is the probability their child is colorblind and type AB a. ½ b. ¼ c. ¾ d. 0 22. Green is a dominant pea trait (G), so is Round (W), and sweet (C). If a GgWwCc X Ggwwcc occurs, what is the probability the ofspring is green, wrinkled, and bitter? a. ½ b. 3/16 c. 1/16 d. 0 e. ¾ 23. If the centromere placement makes the chromosome appear to have only 1 arm, the chromosome is considered a. Arocentric b. Telocentric c. Metacentric d. Submetacentric 24. If a couple wants to have 6 children, 2 of them boys and 4 girls, how many ways could this occur 25. If a couple who are both heterozygous for cystic fibrous want to have 4 children, what is the probability that at least 2 kids have the disease. 26. What is a pseudo autosomal region a. Place on two autosmes that acts like sex chromosomes b. Region on both sex chromosomes that bind together c. Extra autosome regions that don’t efect the genome d. Intergenic sequences on two chromosomes that code for abnormal alleles Exam 3 Topics 1. What X alteration do male flies have? a. Hypoinactivation of X chromosome b. Hyperactivation of x chromosome c. Inactivation of X chromosome d. Repression of X chromosome 2. What type of alteration do human females have? a. Hypoinactivation of X chromosome b. Hyperactivation of x chromosome c. Inactivation of active X chromosome d. Inactivation of Barr body 3. Which is statement is true?

a. Steroids are hydrophobic b. Examples of peptide hormones are insulin and estrogen c. Peptide receptors are transcription factors d. Two of the above 4. Which statement is false? a. miRNA binds imperfectly b. siRNA binds perfectly c. miRNA and siRNA both result in the inhibition and destruction of mRNA d. forgot answer choice e. two of the above 5. LAC operon allolactose and lac I is what type of control a. Positive inducer b. Negative inducer c. Positive repressor d. Negative repressor 6. TRP operon TrpR and tryptophan is what type of control a. Positive inducer b. Negative inducer c. Positive repressor d. Negative repressor 7. LAC operon CAP/cAMP is what type of control a. Positive inducer b. Negative inducer c. Positive repressor d. Negative repressor 8. True or False: Dicer has 2 RNASE domain cut sites and RISC has 1 9. Denote if the following increases, decreases, or keeps the rate of transcription the same a. Increasing the temperature for heat shock genes to 33 degrees Celsius-increase b. Inverting the enhancer site for a transcription factor-same c. Genes inverted from euchromatin to heterochromatin-decrease d. Deacylation of something- decreases 10. Exons in Drosophilia sex-lined genes are an example of what type of gene regulation a. Temperature regulation b. Hormone regulation c. Light regulation d. mRNA splicing 11. Huntington’s disease is caused by: a. An autosomal recessive gene b. An autosomal dominant gene c. Mutation to alanine causing a poly Q region d. Two of the above 12. Cystic Fibrosis is caused by: a. An autosomal recessive gene b. An autosomal dominant gene

13.

14.

15.

16.

17.

18.

19.

20.

21.

c. Mutation to phenylalanine d. Two of the above A map of recombination frequencies is: a. A genetic map b. A physical map c. A cytological map d. A restriction map A map made of putting clones together is: a. A genetic map b. A physical map c. A cytological map d. A restriction map Which could potentially be a restriction site for an endonuclease? a. ACCTATTCACCCATTACA b. CTCGCCAATTGACTCGTC c. ACTCGTCGGACTAGCCCA d. ACTCCACTCCCGACTCCA e. None of the above If the Lac Operon has a mutation that makes lac I/allolactose non-functional: a. The lac operon will not be induced b. If glucose is absent, CAP/cAMP will positively induce the operon c. If glucose is absent, CAP/cAMP will negatively induce the operon d. If glucose is present, CAP/cAMP will positively induce the operon e. If glucose is present, CAP/cAMP will negatively induce the operon If there is a mutation that makes TrpR mechanism inefective, denote whether transcription of tryptophan would still be repressed in presence of tryptophan (true) or continue to be made in spite of excessive tryptophan (false) a. Mutation to regions 3 and 4 that prevent them from binding (false) b. Mutation that causes the ribosome to look for a diferent amino acid (true) c. Mutation that deletes the promoter site (true) A western blot runs: a. DNA on gel, and hybridizes DNA on the probe b. RNA on gel, and hybridizes DNA on the probe c. Proteins on gel, and hybridizes antibodies on the probe A southern blot runs: a. DNA on gel, and hybridizes DNA on the probe b. RNA on gel, and hybridizes DNA on the probe c. Proteins on gel, and hybridizes antibodies on the probe A northern blot runs: a. DNA on gel, and hybridizes DNA on the probe b. RNA on gel, and hybridizes DNA on the probe c. Proteins on gel, and hybridizes antibodies on the probe Which endonuclease could not result from Haemophilus influenza a. HincII

22.

23.

24.

25.

26.

27.

28.

b. HindIII c. HanIII d. Two of the above What regions would be methylated: GC1CUCG2CG3GC4UU a. 1 and 4 b. 2 and 3 c. Only 3 d. Only 1 Which does replication in both eukaryotes and prokaryotes a. YAC b. BAC c. Shuttle d. Cosmids Lac I and allolactose are: a. Repressor/co-repressor b. Repressor/inducer c. Inducer/co-repressor d. Repressor/inducer TrpR and Tryptophan are: a. Repressor/co-repressor b. Repressor/inducer c. Inducer/co-repressor d. Repressor/inducer Genes that are expressed constitutively a. Housekeeping b. Regulated c. Two of above d. None Genes that have specialized functions a. Housekeeping b. Regulated c. Two of above d. None Why do bacteria not attack their own DNA with their endonucleases- they methylate their genome

29. In translational control a. L4 binds to the 3’ termini of S10 b. L4 binds to the 5’ termini of S10 c. When free rRNA is present, translation is inhibited d. When rRNA is bound, translation is promoted 30. Which is false about enhacers? a. They act over long distances b. They engage in a looping mechanism c. They are independent of orientations d. They are found upstream of the promoter 31. In spatial regulation: a. Not every gene product is required in every tissue b. Not every gene product is required at the same time 32. In temporal regulation: a. Not every gene product is required in every tissue b. Not every gene product is required at the same time 33. What percent of the human genome is introns? a. 1.1% b. 24% c. 25% d. 75% Person Man 1 Man 2 Woman 1 Woman 2 Woman 3 Child

Loci 1 (2,5) (7,8) (5,6) (8,7) (7,2) (5,7)

Loci 2 (3,5) (5,8) (5,1) (9,5) (4,5) (5,5)

Loci 3 (7,9) (2,8) (3,6) (3,4) (2,7) (3,7)

Loci 4 (2,6) (4,5) (1,2) (4,7) (1,3) (2,4)

34. Which woman could not be the mother of the child a. Woman 1 b. Woman 2 c. Woman 3 d. All could be the mother 35. Ignoring the potential maternal contributions, which man is not the father a. Man 1 b. Man 2 c. Both could be the father d. Neither could be the father

36. Which mutation elimination would result in a 7000 and 7000 cut site?

a. b. c. d.

Region 2 and 5 Region 2 and 4 Region 3 Region 4...