HW07 vector exercise - hw 07 for chem 472 PDF

Preview

Summary

hw 07 for chem 472...

Description

Name: ________ Biol / HW07 and In class exercise / HW07 Value: 6 pt 1. (0.75 pt) Anatomy of a Genetic Engineering Expression Vector (plasmid pET15b). This is a simpler version of the vectors we will use in our research. Please study the “Expression Vector Terms to Know” listed on the attached page 3. Study the cloning region for the pET15b map at the bottom of page 4. a. On the cloning region at the BOTTOM of the page, circle and label the following: (i) the RNA polymerase binding site (ii) where the ribosome binds (iii) where the repressor (regulatory protein) binds b. (0.75 pt) The “multiple cloning site” for pET15b contains the recognition sequences for THREE consecutive restriction enzymes where the DNA of interest can be inserted. Name the three enzymes, and the use the internet to find the six nucleotide recognition sequence for each. Write the sequences below. Nde1 =========== CA↓TA↑TG Xho1========== C↓TCGA↑G BamHi======== G↓GATC↑C

Name (i) _________ = (ii) _________ = (iii) _________ =

Restriction enzyme recognition sequence 5’ _____________________________ 5’ _____________________________ 5’ _____________________________

c. In prokaryotes, translation usually starts at an AUG (encoded by an ATG) about 8 bp downstream from where the ribosome binds. In the sequence at the bottom of page 4 study the position of the start codon relative to the multiple cloning site. (0.5 pt) (i) How will starting at this start codon affect the primary structure of your genetically engineered protein? (Please be specific.) the addition of these 19 amino acids, means that our primary structure in our genetically engineered protein will be 19 base pair longer, which includes 6x his tag.

(0.5 pt) (ii) Using the internet for information, describe the genetic engineering or protein purification benefit of engineering a protein to contain six histidines in a row.

1

Proteins that contain six his tag can be easily purified and separated from other proteins using a nickel affinity column. Nickel binds to his tag, and keep it from getting washed away, while other proteins without his tag get washed away. ______ + _____ = _____ / 6 2.5

2

3.5

2. Primer design for cloning into pET15b a. Study the 333-nucleotide gene below for the coding region of one subunit of human insulin. (The sequence is continuous for 6 lines of text. The last nucleotide of the gene is in the 6th line.)

*** (0.25 pt) Does the sequence contain a stop codon at the end? NO >reverse translation of gi|30584395|gb|AAP36446.1| Homo sapiens insulin [synthetic construct] to a 333 base sequence of most likely codons

atggcgctgtggatgcgcctgctgccgctgctggcgctgctggcgctgtggggcccggat ccggcggcggcgtttgtgaaccagcatctgtgcggcagccatctggtggaagcgctgtat ctggtgtgcggcgaacgcggctttttttataccccgaaaacccgccgcgaagcggaagat ctgcaggtgggccaggtggaactgggcggcggcccgggcgcgggcagcctgcagccgctg gcgctggaaggcagcctgcagaaacgcggcattgtggaacagtgctgcaccagcatttgc agcctgtatcagctggaaaactattgcaacctg t

b. Please review the PCR slides to see the relative positions of the two primers needed for PCR. Using your information about the pET15b vector, design two PCR primers that can be used to amplify the above insulin gene to be ”cloned” (cut-and-paste) into the multiple cloning site of pET15b vector in the proper orientation (direction) for protein production. To do this, • make sure the proper restriction enzyme sequence occurs in the proper direction • the 5’ primer should have an appropriate 6-base restriction enzyme recognition sequence PLUS 15 bases from the 5’-end the gene (i.e. same sequence as the gene as listed) • The 3’ primer should include nucleotides complementary to the 3’ end of the gene. To the sequence above, (i) write in a stop codon if necessary and then your proposed 6-base restriction enzyme recognition sequence. (ii) Now write the sequence complementary to the end of the DNA sequence you created, including the bases complementary to the last 15 bases of the insulin gene. (iii) Write the primer you designed in the correct space below in the 5’3’ direction. Forward primer 5 atggcgctgtggatg 3

Reverse primer (Not complete) 5 actattgcaacctg TAA 3

3 TGATAACGTTGGAC ATT 5 Reverse primer (complete)

5 ATTCAGGTTGCAATAGT 3

(i) (2.25 pt) The restriction sites I am using are _____Nde I___ at the 5’ start of the gene and __Xbo I__ at the 3’ end (ii) Write your two PCR primer sequences here in the direction you must list it to order from a biotechnology company:

gctgtggatg3 Primer #1: ____5TATGACATATGGc Primer #2: _________5’ TAGTACTCGAGATTCAGGTTGCAATAGT 3 _________________________________________________________

3. (1 pt) Looking ahead. Study the structures of all 20 amino acids. Write the one-letter amino acid code corresponding to the amino acids in the structure below (in the correct order).

3

HAPPY

NEW

4

YEAR

Prokaryotic DNA expression vectors: Terms to know

Origin of replication (ori): start site for replication Promoter (prokaryote): Binding site for RNA polymerase (sigma factor) Transcription start site: First nucleotide that is transcribed Terminator: Sequence that leads to end of transcription Operator: DNA sequence that binding a REPRESSOR PROTEIN (for regulation) (Repressor: a regulatory protein that binds to DNA at the operator and decreases transcription) Ribosome-binding site (Shine Dalgarno sequence, AGGAG_): sequence on mRNA where prokaryotic ribosome will bind Start codon (usually AUG): mRNA sequence where translation begins. In prokaryotes, AUG codes for a modified form of methionine (formyl-methionine, f-met) when it is the right distance from the Shine Dalgarno sequence.) (Note that in the middle of a sequence, AUG will code for regular methionine.) Stop codon: (UAA, UAG, UGA): mRNA sequence that terminates translation. Does not code for an amino acid. Multiple cloning site: a segment of DNA on the vector which has several restriction enzyme sites into which DNA can be inserted

5

Student Name: __________________________________________

pET15b Vector Map (from Novagen)

RNA POLYMERASE BINDING

Repressor binds

6

Ribosome binding...