Manor Biochemistry Notes 2010 PDF

Preview

Summary

Download Manor Biochemistry Notes 2010 PDF

Description

BIOCHEMISTRY MANOR 2010 1. The inhibition in a noncompetitive reaction: a. competes with the active site of the enzyme c. increases the rate of reaction b. binds simultaneously with substrate other than the active site d. both b and c 2. The order and sequence of amino acid in a polypeptide determines what protein structure? a. primary b. secondary c. tertiary d. quaternary 3. Amino acids that cannot be synthesized in the organism are called _________ a. non essential amino acids b. essential amino acids c. standard amino acids d.alpha amino acids 4. Which hormone regulates the level of blood sodium? a. aldosterone b. sterol c. corticosteroid d. cortisone 5. It is a precursor of vitamin A a. B- carotene b. retinol c. retinal d. opium 6. Which of the following is a precursor of vitamin D? a. prostaglandin b. linoleic acid c. cholesterol d. aldosterone 7. Which of these class enzymes introduces a double bond by the removal of hydrogen? a. dehydrogenase b. dehydrolase c. decarboxylase d. lipase 8. The ionic property of amino acid is exhibited by its a. zwitterions form b. NH2 group c. COO group d. positively charged groups 9. All of the following are simple proteins except: a. glutelins b. globulins c. albumins d. glycoproteins 10. The simplest monosaccharide is a. erythrose b. starch c. glyceraldehydes d. arabinose 11. Denaturation of protein is a result of: a. cleavage of the peptide bond b. Formation of H- bond c. breaking of H- bond d. none of these 12. Competitive inhibition is a __________ reaction a. reversible b. irreversible c. pH and temperature d. none of these 13. In the Seliwanoff’s test, the reaction of resorcinol and acid on the sugar forms a. hydroxymethyl furfural b. pyranose c. hydrazine d. purine 14. High concentration of neutral salts causes the precipitation of proteins. This is called ________ a. salting out b. salting in c. coagulation d. both b and c 15. The type of enzyme inhibition reaction whereby the inhibitor competes with the substrate at the active site: a. competitive inhibition c. reversible inhibition b. noncompetitive inhibition d. incomplete inhibition 16. The following are waxes except: a. beeswax b. sperm oil c. bile acids d. lanolin 17. The inactive form of enzymes are called: a. zymogens b. apoenzymes c. cofactor d. both b and c 18. Which of the following amino acids has no alpha amino group? a. proline b. hydroxyproline c. glycine d. both a and b 19. An enzyme is a substance which a. convert heat to energy c. change chemically in reaction b. act as a catalyst d. is not specific in reaction 20. Milk curdling enzyme present in gastric juice of infants: a. pepsin b. rennin c. trypsin d. maltase 21. Carbohydrates are a. polyhydroxyaldehydes/ polyhydroxyketones c. polyhydroxy acids b. hemiacetals d. polymers of amino acids 22. Insulin is usually classified as: a. protein b. enzyme c. hormone d. carbohydrates 23. What amount of glucose is present in the human blood? a. 60 to 90 mg in 100ml blood c. 2% of the total human body weight b. 5 to 6 g in 100ml blood d. none of these 24. It is the organelle which serves as the site of the electron transport chain. a. mitochondria b. ribosome c. nucleus d. lysosome

BIOCHEMISTRY MANOR 2010 25. The end product of the hydrolysis of glycogen is: a. galactose b. fructose c. glucose d. arabinose 26. Iodine test is a reaction which may be used to identify carbohydrates. The reaction is due to a. presence of the free aldehyde group c. presence of amylose portion b. presence of alcohol group d. presence of glucose 27. Benedict’s reagent yield positive result to: a. monosaccharide only b. reducing sugars c. sucrose d. polysaccharides 28. Hypertonic solutions will cause the cell to: a. swell b. shrink c. burst d. undergo hydrolysis 29. Rancidity of fats maybe due to: a. oxidation b. hydrogenation c. saponification d. condensation 30. The deficiency of this hormone causes diabetes mellitus: a. progesterone b. testosterone c. insulin d. glucagons 31. The active proteolytic enzyme in gastric juice is: a. pepsin b. trypsin c. maltase d. catalase 32. The site of oxidation reaction in electron transport chain is in the a. nucleus b. mitochondrion c. ribosome d. golgi bodies 33. Protein digestion starts in the a. mouth b. stomach c. intestine d. pancreas 34. The conversion of an amino acid to sugar is: a. gluconeogenesis b. glycolysis c. glycogenesis d. glycogenolysis 35. Which of the following is not an amino acid? a. leucine b. choline c. valine d. glycine 36. The protein part of the enzyme molecule is the: a. apoenzymes b. coenzyme c. cofactor d. holoenzyme 37. Optimum temperature for enzyme activity in the body: a. 40°C b. 60°C c. 37°C d. 10°C 38. Glucose is stored in the liver as: a. galactose b. glycogen c. lactose d. fructose 39. The enzyme conformation adapts to the incoming substrate in a. Lock and Key theory c. competitive inhibition b. Induced fit theory d. noncompetitive inhibition 40. The process of converting glucose into glycogen is called: a. gluconeogenesis b. glycogenesis c. glycolysis d. glycogenolysis 41. All are pyrimidine bases except: a. guanine b. cytosine c. uracil d. thymine 42. Glucose, amino acid and fatty acid enter the citric acid cycle by their conversion into: a. pyruvate b. acetyl CoA c. acetoacetyl CoA d. palmitic acid 43. A hormone which stimulates glycogenesis: a. insulin b. glucagons c. epinephrine d. vasopressin 44. Chemicals extracted from organism such as bacteria and can inhibit growth or destroy other microorganism: a. antibiotic b. enzyme c. hormone d. vitamins 45. The gland or tissue that regulates the blood glucose level: a. parathyroid b. thyroid c. pancreas d. adrenal 46. Which vitamin is formed in the body by exposure to ultraviolet irradiation or sunlight? a. vitamin A b. vitamin B c. vitamin C d. vitamin D 47. Excess vitamin A and D is stored in the body, but excess vitamin and C is readily excreted. What property shows this? a. vit. C and B are water- soluble b. vit.A and D are fat- soluble c. both a and b d. none of these 48. It is the entire genetic makeup of an organism a. gene b. anticodon c. codon d. mutation 49. The vitamin which is used in the prevention of degenerative changes in the central nervous system:

BIOCHEMISTRY MANOR 2010 a. vit. A b. vit. B complex c. vit. C d. vit. D 50. It is a model which best explains the enzyme-substrate action: a. lock and key b. molecular c. VSEPR d. Kreb 51. The activation of pepsinogen requires: a. pepsin b. NaOH c. enterokinase d. HCl 52. DNA is primarily found in the a. cytosol b. nucleus/mitochondria c. cell wall d. endoplasmic reticulum 53. It is the enzyme which hydrolyzes starch to dextrin and maltose: a. catalase b. amylase c. pepsin d. lactase 54. A synthetic DNA is called a. replicated DNA b. plasmid c. Gene d. recombinant DNA 55. Hydrolysis of ATP is an a. energy requiring reaction c. no energy is involved b. energy producing reaction d. energy is absorbed 56. Which of the following is a characteristic of lipid? a. zwitterions b. amphiphilic c. hydrophobic d. hydrophilic 57. It is a condition that results when sugar level is below normal a. hypoglycemia b. hyperglycemia c. ketonuria d. uremia 58. An example of globular protein a. albumin b. collagen c. fibrin d. silk 59. Complementary base pairs in the DNA double helix are bonded by a. H-bond b. Van der Waals c. ester bond d. dipole-dipole 60. Which nitrogen base is not found in DNA? a. thymine b. cytosine c. uracil d. guanine 61. An organic cofactor in an enzyme a. vitamins b. coenzymes c. a and b d. none of these 62. At what stage of glucose oxidation is most of the energy produced? a. glycolysis b. aerobic stage c. glycogenesis d. glygenolysis 63. The best known building blocks of RNA and DNA are: a. purines b. pyrimidines c. fatty acids d. a and b 64. It is responsible for the storage and transmission of genetic information a. adenine b. RNA c. DNA d. nucleic acid 65. Build up of urea in the blood is called a. ketonuria b. glycemia c. uremia d. all of these 66. The transfer of genetic information from DNA by the formation of mRNA a. transcription b. translation c. trans-amination d. replication 67. What is the end product of electron transport chain? a. oxygen b. hydrogen c. carbon dioxide d. water 68. The energy producing reaction a. metabolic b. catabolic c. anabolic d. all of these 69. It is the molecule that directs the activityof the cells a. DNA b. RNA c. nucleoproteins d. hormones 70. The sugar involved in DNA a. ribose b. pentose c. deoxyribose d. xylose 71. The common metabolic pathway is a. glycolysis b. beta oxidation c. Kreb’s cycle d. glucogenesis 72. Rosenheim’s test is used to detect the presence of: a. ethanolamine b. choline c. cholesterol d. glycone moiety 73. Detects the presence of alpha amino acids: a. Biuret b. Molisch c. Ninhydrin d. Hopkins-cole 74. The process of producing fats from acetyl Co-A is called: a. glycolysis b. lipogenesis c. glycogenolysis d. glucogenesis 75. The following are test reagents to detect the presence of amino acids, except: a. Grignard’s b. Xanthoproteic c. Millon-Nasse d. Sakaguchi

BIOCHEMISTRY MANOR 2010 76. The condition that lowers the pH of the blood due to starvation is called a. acidosis b. alkalosis c. hyperglycemia d. glycosuria 77. The substance responsible for the emulsion of fats is: a. HCl b. bile acids c. pepsin d. trypsin 78. Hubl’s solution if used to ascertain degree of: a. saturation b. unsaturation c. peroxidation d. acidity 79. IUPAC name of acrolein: a. pentenal b. propenal c. hexanal d. acetone 80. The positive indication for the presence of glycerol in acrolein test: a. yellow colored solution c. silver mirror formed in the test tube b. black markings in filter paper d. play of colors from blue to shades of red 81. Cerebrosides are positive in the following tests, except: a. Molisch b. Biuret c. Lassaigne’s d. none of the above 82. Osmic test is used to detect the presence of __________ in lipids: a. metals b.prosthetic groups c. unsaturated groups d. glycerol 83. The most sensitive chemical test to detect the presence of cholesterol: a. Liebermann-Burchard c. Formaldehyde-sulfuric acid b. Salkowski reaction d. Colorimetric spectrophotometry 84. The following are phospholipids, except: a. plasmalogen b. lecithin c. cephalin d. choline 85. A mixed triglyceride contains: a. three similar fatty acids esterified with glycerol b. two similar fatty acids esterified with glycerol c. three different fatty acids esterified with glycerol d. all of the above choices 86. The central compound found in the structure of sphingolipids: a. glycerol b. sphingosine c. ceramide d. phosphocholine 87. Lipid whose specific test is the Furter-Meyer test: a. tocopherol b. retinal c. sphingomyelin d. cerebroside 88. Precipitate of _________ indicates the presence of phospholipids in the lipid sample: a. ammonium phosphomolybdate c. phosphorus triiodide b.phosphorus periodate d. phosphor-ammonium sulfate complex 89. The following are glycolipids, except: a. globosides b. phosphatides c. gangliosides d. cerebrosides 90. The parent compound of phospholipids: a. glycerol b. phosphatidic acid c. ethanolamine d. none of the above 91. A non- pentose sugar which is also positive for Tollen’s phloroglucinol test: a. galactose b. glucose c. fructose d. cellobiose 92. The reagent present in Molisch test which is responsible for the dehydration reaction: a. sodium carbonate b. magnesium stearate c. sulfuric acid d. NaOH 93. ID test to detect the presence of glycogen: a. phloroglucinol b. molisch c. iodine d. seliwanoff 94. The only sugar readily forms insoluble osazone crystals: a. lactose b. sucrose c. mannose d. sucrose 95. Important structural material found in the exoskeleton of many lower animals: a. chondroitin b. heparin c. hyaluronic acid d. chitin 96. Hydrolysis of osazones produce: a. phenylhydrazones b. ozones c. sugars d. none of the above 97. General term for a group of polysaccharides present on the primary cell wall: a. xanthan b. mucilage c. pectin d. carageenan 98. Specific test for galactose, due to the formation of highly insoluble crystals: a. phenylhydrazine test b. fermentation c. mucic acid d. molisch 99. Type of RNA which serves as template for the amino acid sequence being synthesized: a. mRNA b. tRNA c. rRNA d. snRNA

BIOCHEMISTRY MANOR 2010 100. Positive indication for Anthrone test: a. purple ring b. blue-green color c. effervescence 101. Differentiating test between helical and linear polysaccharides: a. Molisch

b. iodine

c. Schweitzer

d. yellow ppt d. fermentation

102. The difference between Benedict’s and Barfoed’s test reagent lies in: a. sequestering agent used

b. active component used

c. pH of the solution

d. alkali used

103. Hydrolytic product of chitin: a. iduronatet d. glucuronic acid

b. acetylgalactosamine

c. acetylglucosamine

104. Glucose and fructose are: a. anomers

b. epimers

c. geometric isomers

d. allosteres

105. The complementary strand of CGACCTTGATCGACGTCGA: a. TCGTTCCAGCTAGTAACTAG b. GCTGGAACTAGCTGCAGCT

c. AGCAAGGTCGATCATGATC d. ATCAAGGTCGATCATGATC

106. Alkaline bismuth reagent is used to detect the presence of: a. polysaccharides d. glycitols

b. disaccharides

c. reducing sugars

107. Action of dilute alkali on sugars: a. dehydration d. tautomerization

b. hyperconjunction

c. hydrolysis

108. The following are the components of DNA nucleosides, except: a. phosphoric acid

b. sugar

c. adenine

d. cytosine

BIOCHEMISTRY MANOR 2010 109. Central dogma concept wherein the RNA molecule is used as template for the synthesis of DNA molecule: a. transcription d. none of the above

b. translation

c. mutation

110. The following proteins are present in egg white, except: a. ovomucin d. osseomucoid

b. ovoglobulin

c. albumin

b. mitochondria

c. cytoplasm

111. Anaerobic glycolysis occurs in the: a. nucleus d. lysosomes

112. Ketogenic amino acids: a. leucine

b. tyrosine

c. phenylalamine

d. all of the above

113. Osazone test is also known as: a. Nylander’s test d. Folin’s test

b. Kowarsky test

c. Trommer’s test

114. Genetic defect characterized by mental retardation and cataract, since the sugar is toxic to the

unmetabolized

lens of the eyes: a. galactosemia d. fructosuria

b. fructosemia

c. pentosuria

115. Body functions of lipids: a. transformation into proteins and carbohydrates paddings for organs b. catabolism to provide body with heat and energy

c. insulation and d. all of the above

116. Pyridoxine is a compound of this enzyme: a. enolase

b. decarboxylase

c. hydrogenase

d. isomerase

BIOCHEMISTRY MANOR 2010 117. The following are neutral amino acids, except: a. methionine

b. lysine

c. threonine

d. leucine

118. In man, the principal end product of protein metabolism is: a. uric acid

b. lactic acid

c. pyruvic acid

d. urea

119. Condition wherein acetone accumulates in the blood: a. ketosuria

b. ketonemia

c. ketosis

d. ketonuria

120. Glutamine is a _____ amino acid : a. neutral

b. basic

c. acidic

d. racemin

121. Oxidation product of ketone bodies: a. reduced sugars

b. carbon dioxide

c. alcohols

d. aldehydes

122. Phosphoprotein found in egg yolk: a. ovocasein

b. tendomucoid

c. vitelin

d. avidin

123. Amino acids positive for Sakaguchi reaction: a. gelatin

b. alanine

c. arginine

d. tyrosine

124. Histidine is negative for: a. Pauly reaction d. Xanthoproteic

b. Sodium Nitroprusside

c. Ninhydrine

125. An official simple protein obtained from corn: a. glutelion

b. gliadin

c. zein

126. Principle involved in the isolation of casein milk:

d. maize

BIOCHEMISTRY MANOR 2010 a. salting in precipitation

b. salting out

c. isoelectric

d. none of the above

127. Process of converting liver glycogen into blood glucose: a. glycogenolysis d. glycogenesis

b. gluconeogenesis

c. glycolysis

128. Genetic information is stored and carried in all cells by: a. single-stranded DNA

c. double-stranded RNA

b. double-stranded DNA

d. single-stranded circular DNA

129. Principal site for the synthesis of urea: a. kidney

b. liver

c. spleen

d. intestinal mucosa

130. Pentose present in gum Arabic: a. xylose

b. ribose

c. arabinose

d. threose

131. Which of the following is responsible for the transfer of genetic information? a. ATP

b. GTP

c. DNA

d. RNA

132. Only form of inorganic nitrogen which can be utilized by living cells: a. urea

b. ornithine

c. ammonia

d. nitrogen gas

133. The following are essential amino acids, except: a. tyrosine

b. lysine

c. methionine

d. arginine

134. The chief end product of purine metabolism in man: a. CO

b. urea

c. uric acid

d. ammonia

135. The principal end product of protein metabolism: a. carbon dioxide

b. ammonia

c. hippuric acid

d. urea

BIOCHEMISTRY MANOR 2010

136. Presence of glucose in appreciable amounts in the urine: a. Hematuria

b. glycosuria

c. glycosemia

d. albuminuria

137. The following are the tests for kidney efficiency, except: a. phenylsulfophthelein test b. urea clearance test d. crystallization method

c. water output test

138. Growth hormone is also known as: a. thyrotropic hormone interstitial stimulating hormone

b. somatotropin

c. gonadotropind.

139. What is the anti-codon in tRNA that corresponds to the codon ACG in mRNA? a. UGC

b. TGC

c. GCA

d. CGU

140. Condition wherein bile pigment is present in excess in the blood: a. jaundice

b. hepatitis

c. cirrhosis

d. cystic fibrosis

141. The following are non-essential amino acids, except: a. glycine

b. leucine

c. cysteine

d. glutamine

142. Principal digestive constituent of the gastric juice: a. trypsin

b. pepsin

c. gastrin

d. enterokinase

143. Condition wherein the concentration of uric acid accumulates in blood high as 15 mg. Percent: a. leukemia

b. gout

c. murexia

d. any of the above

144. The study of the composition and the chemical processes occurring in the is: a. qualitative chemistry

reaches as

c biochemistry

living matter

BIOCHEMISTRY MANOR 2010 b. organic chemistry e. inorganic chemistry

d. quantitative chemistry

145. What is wobble? a. b. c. d.

the ability of certain anticodons to pair with codons that differ at the third base an error in translation induced by streptomycin a mechanism that allows for a peptide extension in the 50S sub-unit of the ribosome thermal motions leading to local denaturation of the DNA double helix

146. The most important function of HCl i...