Title | Assignment 1 |
---|---|
Author | Ovin Balasooriya |
Course | Molecular and Microbial Genetics |
Institution | South Dakota State University |
Pages | 3 |
File Size | 177.3 KB |
File Type | |
Total Downloads | 65 |
Total Views | 200 |
Assignment 1 of the course...
Ovin Balasooriya MICR 448
Assignment 1
1. The question is done in a paper and the photograph is attached below.
2. 5’GTATCGTATGCATGCATCGTGAC 3’ 3’CATAGCATACGTACGTAGCACTG 5’
a) The template strand is the 3 prime ending strand which is as follows,
3’CATAGCATACGTACGTAGCACTG 5’
b) The mRNA sequence produced is as follows,
5’AUCGUAUGCAUGCAUCGUGAC 3’
c) The initiation codon of this mRNA is AUG because the transcription site starts from the first U in the sequence. 5’AUCGUAUGCAUGCAUCGUGAC 3’ d) Yes, it will affect the process. The reason is as follows, If the first G in the sequence is to be changed to a C then the AUC in the mRNA will change to AUG and that will act as a translational start site and it will create a longer open reading frame due to the AUG been three codons upstream from its place. This will result in the protein behaving as a different one with the variation of the initiation codons.
e) Yes, it will affect the process. The reason is as follows, Shifting the second T in the sequence which is within the template strand to a G may produce a short open reading frame because starting with the change the starting AUG would be more downstream....