Bioinformatics lab PDF

Preview

Summary

Bioinformatics Lab ...

Description

ANSWER DOCUMENT BIOINFORMATICS LAB – ONLINE ASSIGNMENT

Biol 211l Cellular & Organismal Biology Laboratory

Central Dogma – The Basics After completing the animations at the Learn Genetics website, answer the following questions: 1. What is the sequence of nucleotides in the RNA you created? (0.5 pt) UAAUGCUAGACGUGUUCUAGGA 2. What is the sequence of amino acids in the protein you created? (0.5 pt) Methionine, Leucine, Aspartic acid, Valine, Phenylalanine, STOP. 3. The start codon. What is the RNA sequence of the start codon? What amino acid is inserted in the protein when the start codon is translated? (1.0 pt) UAA is the start codon and the amino acid that is inserted is Leucine. 4. Stop codons. What are the RNA sequences of the three stop codons? Are there amino acids inserted into the protein when a stop codon is translated? (1.0 pt) AGG is the stop codon and the amino acid that is inserted for the translated stop protein is Arginine. When Something Goes Wrong Complete the table below with information about the CFTR mutant sequences. (0.25 pt per box) DNA Sequence

Amino Acid Sequence

Type of Mutation

G changed to A; position 3321

Phe,Pro,Asp,Thr,Cys,Glu,Ala,Arg,Lys,Pro,Ala

Missense

Deletion of T at position 3326

Phe,Pro,Asp,Thr,Cys,Gly,Thr,Glu,Ala,Cys,Stop

Nonsense

deletion of 3 nucleotides at position 3322-3324

Phe,Pro,Thr,Cys,Glu,Ala,Lys,Pro,Ala

Frameshift

Colon Cancer: A Case of Genetic Bad Luck? 5. What is the difference between the normal APC gene and Sam’s APC gene sequence? (0.5 pt) In the entirety of the two APC gene sequences there is only one difference between Sam’s sequence and the normal sequence. The difference is on the 1741 to 1800 in which the 8 th nucleotide is an A instead of a T which means a mutation has occurred. 6. Based on the comparison of the normal APC gene sequence to Sam’s APC gene sequence, what type of mutation might be found in Sam’s APC gene? (0.5 pt) Sam has a point mutation in which during DNA replication, one nucleotide is in place of another. In his case it is the A nucleotide instead of the T nucleotide. A point mutation can have no affect on some people but in Sam’s case the mutation is lethal and has lead to him getting colon cancer. The possible point mutations affecting Sam could be missense or

frameshift (insertion/deletion). Sam has a change in one amino acid in which could include one added in place of another, the deletion of an amino acid and another out in its place and an open reading frame change.

7. Compare the normal APC gene sequence and Sam’s APC gene by completing the following table: (0.5 pt per box in the table) APC sequence

ORF # Length of ORF 1st nucleotide Last nucleotide Protein length

Normal

1

8532nt

19

8550

2843aa

Sam’s

2

6432nt

2119

8550

2143aa

8. What do you notice when you compare Sam’s APC protein translation to the normal APC protein? (0.5 pt) The difference in Sam’s sequence include the ORF#, the length of the nucleotides and proteins as well as the 1st nucleotide number. Both Sam’s and the normal APC sequence end at the same nucleotide but that is the only similarity. Sam’s open reading frame should be number one but it is number two, the length of the open reading frame in Sam’s sequence is shorter than normal but 2100nt, the 1st nucleotide for Sam is 2119 when it should be 19 and the protein length for Sam is 700aa shorter than the normal APC sequence. 9. Consider your answer to question #6 above and the differences in Sam’s APC protein compared to the normal protein. What type of mutation is found in Sam’s APC gene? (1.0 pt) Sam has a frameshift mutation in his APC gene sequence. Sam has several differences from the normal sequence including the change in number of the open reading frame which is the main indicator in a frameshift mutation. Although a change in a single amino acid occurred such as in a missense and or insertion or deletion mutation , because the open reading frame also had a different number of shows that it will be in a frameshift mutation which also consists of a change in a single and or multiple amino acids. Implications Advances in genetics now make it possible to test DNA sequences for the presence of diseasecausing mutations. The ability to detect familial adenomatous polyposis (FAP) by analyzing the APC gene is only one example. Genetic tests are currently available for more than 2,000 diseases (CDC, 2013). These tests can provide doctors and patients with a diagnosis or possible treatment procedures. 10. Knowing Jane’s family history for colon cancer, do you believe she should be tested to determine if she has a mutation in her APC gene? Why or why not? (1.0 pt) Yes, Jane should get tested because the mutation from colon cancer is hereditary based on the pedigree diagram. The mutation is in Janes grandfather, father, and now her brother meaning she may possibly have the mutation as well. Centers for Disease Control, 2013. Genetic Testing. Retrieved from http://www.cdc.gov/genomics/gtesting/index.htm M h 11 2013

Biol 211l Cellular & Organismal Biology Laboratory

ANSWER DOCUMENT

11. What might be some advantages to being tested for a genetic disease? (0.5 pt) An advantage would be knowing whether or not there is a mutation which would allow for Jane to catch the cancer earlier on and frequently get tested for it rather than being surprised like her brother who got diagnosed later than he would have known.

12. What might be some of the disadvantages of genetic testing? (0.5 pt) Some disadvantages to genetic testing are that it is an expensive and lengthy process because familial adenomatous polyposis is specific to a different gene in each individual so all of the APC would need to be looked at not just one specific gene.

13. If there were a condition in your family history that could be identified with a genetic test, would you consent to having your DNA tested? Why or why not? (1.0 pt) I would consent to having my DNA tested because I would want to know before it was to late. Both of my grandmas have had breast cancer and I have had leukemia so I would want to be tested to see if I had the breast cancer gene because I wouldn’t want it to get to a point where there was nothing I could do to stop it from killing me....