Tutorial 3 Student Guide PTC Tasting and Bioinformatics S20 PDF

Preview

Summary

Download Tutorial 3 Student Guide PTC Tasting and Bioinformatics S20 PDF

Description

Biology 1M03 – Tutorial 3 PTC Tasting and Bioinformatics Objectives By the end of this tutorial students should be able to: • • • • •

Define and identify synonymous and non-synonymous substitutions. Define and identify different types of mutations. Translate the genetic code. Be familiar with amino acid nomenclature. Identify evidence for convergent evolution.

Preparation  Read the introductory material in this student manual.  Read section 55.5 in the Human Evolution supplement that is posted on AVENUE.  Read Bioskills 11 in the Bioskills section at the back of Biological Science 3rd Canadian Edition (B42 – B43).  Review the information at the following link: http://www.ncbi.nlm.nih.gov/Class/MLACourse/Modules/MolBioReview/iupac _aa_abbreviations.html  Complete the AVENUE pre-tutorial quiz

1

Introduction Mutations result in change to an organism’s DNA sequence. Some nucleotide changes result in a change to the amino acid that is coded for by that particular codon, while others do not. This is possible because of the redundant nature of the nuclear genetic code. Single nucleotide difference between DNA sequences are called single nucleotide polymorphisms, or “SNPs”.

Figure 1 The nuclear genetic code. As you can see in the table above, changing the third nucleotide in many cases does not result in an amino acid change. Synonymous mutations do not change the amino acid sequence in a protein. Non-synonymous mutations result in an amino acid change that changes the protein. These changes could be structural or and/or functional and potentially result in a non-functional protein. The substitution or insertion of a single nucleotide is called a point mutation. Different types of point mutations and their outcomes can be seen in the table below.

2

Table 1 Point mutations and their outcomes. Silent mutation

Change in nucleotide that does not change the amino acid coded for by the codon. Change in genotype but not phenotype Nucleotide change that results in a new amino acid coded for by the codon. Change in primary protein structure. Nucleotide change that results in a stop codon. An addition or a deletion of a nucleotide that results in a different reading frame.

Missense mutation

Nonsense mutation Frameshift mutation

As revealed during tutorial 2, humans and chimpanzees have both lost the ability to taste PTC but this loss of trait was derived via convergent evolution. Many of the differences seen in chimpanzee and human genotypes and the resultant phenotypes are due to single nucleotide polymorphisms. Humans and chimpanzees nucleotide sequences are genetically different by only 1.3% in the 300 billion bases found in the human genome. Small changes can result in big differences. The most significant difference in gene expression between humans and chimpanzees occurs in brain cells. The term “haplotype” refers to the particular combination of alleles that are present on a chromosome. Haplotypes are often coined with respect to the differences that occur between genomes, nucleotide sequence, or amino acid sequences for a particular trait.

3

IN-CLASS ACTIVITY: Translating the Genetic Code

The following DNA sequence is found on the coding strand of a piece of double stranded DNA. What amino acid sequence would be present after translation? 5’ ATGATAAGTAGCTGA 3’

5’ AUG l AUA l AGU l AGCl UGAl 3’ What does ATG signify in a DNA coding sequence? Start Codon

What does TGA signify in a DNA coding sequence? Stop Codon

IN-CLASS ACTIVITY: Identify Sequence Differences

The amino acids sequences of Homo sapiens tasters and non-tasters are seen below. Identify differences in the sequences. Taster 1 Non 1

mltltrirtv syevrstflf isvlefavgf ltnafvflvn fwdvvkrqpl snsdcvllcl mltltrirtv syevrstflf isvlefavgf ltnafvflvn fwdvvkrqal snsdcvllcl

Taster 61 Non 61

sisrlflhgl lflsaiqlth fqklseplnh syqaiimlwm ianqanlwla aclsllycsk sisrlflhgl lflsaiqlth fqklseplnh syqaiimlwm ianqanlwla aclsllycsk

Taster 121 lirfshtfli claswvsrki sqmllgiilc scictvlcvw cffsrphftv ttvlfmnnnt Non 121 lirfshtfli claswvsrki sqmllgiilc scictvlcvw cffsrphftv ttvlfmnnnt Taster 181 rlnwqikdln lfysflfcyl wsvppfllfl vssgmltvsl grhmrtmkvy trnsrdpsle Non 181 rlnwqikdln lfysflfcyl wsvppfllfl vssgmltvsl grhmrtmkvy trnsrdpsle Taster 241 ahikalkslv sffcffviss caafisvpll ilwrdkigvm vcvgimaacp sghaavlisg Non 241 ahikalkslv sffcffviss cvafisvpll ilwrdkigvm vcvgimaacp sghaailisg Taster 301 naklrravmt illwaqsslk vradhkadsr tlc Non 301 naklrravmt illwaqsslk vradhkadsr tlc

4

At which amino acid positions have mutations occurred? 49, 262, 296

Which amino acids are present at these positions for tasters? PAV

Which amino acids are present at these positions for non-tasters? AVI

What term do you predict would represent the taster haplotype? PAV/PAV

What term do you predict would represent the non-taster haplotype? AVI/AVI

Using the Homo sapiens taster and non-tasters amino acid sequences, calculate percent difference of the amino acid sequences using the following formula │

First Value - Second Value (First Value + Second Value)/2

333-330 __________ x 100 333+330/2 3 _________ 331.5

= 0.9

X 100

│ × 100%

TUTORIAL 3: POST-TUTORIAL ASSIGNMENT Name:________________________________________ Hadassah Annor Tutorial Section: __T05 ___

Student #:_____________________ 400260899

Michelle Brown TA:________________________

___

1. Kate is homozygous dominant for h er ability to taste PTC? Compose the term that would represent her haplotype with respect to her ability to taste PTC (Hint: every individual has two copies of each chromosome). (1 mark) Chromosome 1 Chromosome 2

PAV

PAV

2a. Which nucleotide changes are responsible for the amino acid differences between Homo sapiens tasters and non-tasters? Name the nucleotides. (6 marks) C changed to G

-Proline changed to Alanine

C changed to U

-Alanine changed to Valine

G changed to A

-Valine changed to Isoleucine

2b. At which nucleotide positions in the nucleotide sequences do these changes occur? (3 marks) Non-tasters has “G” at nucleotide position 145, “T” position at 785, and “A” position at 886

2c. Which type(s) of point mutations are occurring? (1 mark)

Missense Mutation

(Nucleotide changes result in new amino acids.)

6

3. The amino acid sequence seen below is from a Gorilla gorilla (Western Lowland Gorilla). Make a prediction as to whether this primate is a PTC taster, or a non-taster and justify your answer. (2 marks) 1 61 121 181 241 301

mltltrirtv sisrlflhgl lirfshtfli rlnwqikdln ahikalkslv naklrravtt

syevrstflf lflsaiqlth claswvsrki lfysflfcyl sffcffviss illwaqsslk

isvlefavgf fqklseplnh sqmllgiilc wsvppfllfl caafisvpll vranhkadsr

ltnafvflvn syqaiimlwm scictvlcvw vssgmltvsl ilwrdkigvm tpc

fwdvvkrqpl ianqanlwla cffsrphftv grhmrtmkvy vcvgimaacp

snsdcvllcl aclsllycsk ttvlfmnnnt irdsrdpsle sghaavlisg

This primate is a PTC taster because the common taster allele contains C145, C785, and G886, all of which produces a polypeptide with 49 proline, 262 alanine and 296 valine, which is also known as the PAV allele.

4. Humans and chimpanzees derived the loss of PTC tasting trait via convergent evolution as mentioned during tutorial 2. Beginning with the first amino acid, examine the nucleotide sequences below of a non-taster human and non-taster chimpanzee and give support to the claim that the loss of trait was derived via convergent evolution. (2 marks) (Hint – the ATG seen in the middle of the sequence if there was a shift of the reading frame is not a start codon) Homo sapiens 1 ATGTTGACTCTAACTCGCATCCGCACTGTGTCCTATGAAGTCAGGAGTACATTTCTGTTC Pan troglodytes 1 AGGTTGACTCTAACTCGCATCCGCACTGTGTCCTATGAAGTCAGGAGTACATTTCTGTTC

Humans have the start codon AUG, but have lost the ability to taste PTC due to the possibility of other non-synonymous mutations. Therefore, they produce a protein not produced by chimps, due to missense mutation. In contrast, while chimps have lost the taste of PTC due to the absence at start codon, chimpanzees might have had a mutation at one nucleotide, leading to a different nucleotide sequence. Also in contrast to this, humans have evolved a haplotype which represents non-taster AVI vs. taster PAV. 7

5. The nucleotide sequences of humans and chimpanzees differ by 1.3%. One common misconception about human evolution is that humans evolved from chimpanzees. Using the information in the figure below, provide an answer that invalidates this misconception. According to the figure below, are humans more closely related to gorillas or chimpanzees? (3 marks)

Modern humans rather, share a recent common ancestor. Orangutangs, gorillas, humans, bonobos and chimpanzees are called apes because humans are sister taxa with chimpanzees which means they evolved from a recent common ancestor, not from modern chimpanzees.

Tutorial 3: PTC Tasting and Bioinformatics Total: /18 8...