Biology 107AS Discussion Problems Week 2 PDF

Preview

Summary

mandatory assignments...

Description

Biology 107A Discussion Problem Set #1:DNA Structure

April 10th 2017

1. (a) Draw the complementary sequence for the following single strand of DNA: 5’ CTATCGATTCAACGAAATTCGCAAGGCATT 3’ 3’ GATAGCTAAGTTGCTTTAAGCGTTCCGTAA 5’

(b) Transcribe the double-stranded DNA from question 1a into a single-stranded mRNA using the top strand as the template. 3’ GAUAGCUAAGUUGCUUUAAGCGUUCCGUAA 5’

2. DNA isolated from the bacterial virus M13 contains 25% A, 33% T, 22% C, and 20% G. Do these results strike you as peculiar? Why or why not? How might you explain these values? A – 25% T – 33%

Yes, peculiar, since A pairs with T and the pairs do not match with each other. Chargaff’s rule states that A=T and G=C so pairs have to be the same concentration with each other. The viral genome is probably single stranded and doesn’t follow the rule.

C – 22% G – 20%

3. Calculate the melting temperature for the following sequence: AGGTCCAGCCCAATTGGA Tm = 4 x (G+C) + 2 x (A+T) 10 x 4 + 8 X 2 = 56 °C...