DNA to Disease Worksheet(1) PDF

Preview

Summary

Due Week 7....

Description

Connect the dots…DNA to DISEASE Introduction We’ve learned that DNA is the genetic material that organisms inherit from their parents, but have you ever thought about what exactly this DNA encodes for? How do our cells use DNA as a set of instructions for life? How is the information in our DNA/genes used by our bodies? And what happens when the DNA is mutated or not used properly? Materials DNA sequence Computer with an internet connection Procedure 1. Obtain your DNA sequence from your teacher. It will be posted for you at the beginning of the week. 2. Convert your DNA sequence into a complementary mRNA sequence. EXAMPLE: DNA: TAC G G C TA G ↓ mRNA: AU G C C GAU C CHOOSE SEQUENCE 1 Your DNA sequence: tacgagtgtaagtaccggagactgtcgctccttcttcacacacta

mRNA sequence:

augcucacauucauggccucugacagcgaggaagaagugugugau

3. Determine the codons. EXAMPLE: mRNA: Codons:

AU G C C GAU C ↓ AUG CCG AUC

Codons: aug cuc aca uuc aug gcc ucu gac agc gag gaa gaa gug ugu gau

4. Translate the codon sequence into an amino sequence. Use the chart provided. Codons: AUG CCG AUC ↓ Amino Acids: Methionine Proline Isoleucine Amino Acid Sequence: 1.methionine 6. alanine 11.glutamic acid

2.leucine 7. serine 12.glutamic acid

3. threonine 8. aspartic acid 13.valine

4. phenyl-alaine 9. serine 14. cysteine

5. methionine 10. glutamic acid 15.aspartic acid

5. Write out the one-letter abbreviations for the amino acids in the sequence. Use the chart provided. M LTF MAS D S E E E VC D AMINO ACID Alanine Arginine Asparagine Aspartic acid Cysteine Glutamine Glutamic acid Glycine Histidine Isoleucine

abbreviation A R N D C Q E G H I

AMINO ACID Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine

6. Go to http://www.ncbi.nlm.nih.gov/BLAST/ and choose Protein-Protein BLAST (top of the second column). 7. Enter the one-letter abbreviations for your amino acid sequence in the SEARCH box – be sure to enter them in the correct order!

abbreviation L K M F P S T W Y V Possible proteins Presenilin 2 BRCA 2 Synuclein Dystrophin Laforin Apolipoprotein E Leptin

8.

Click on the “BLAST” button.

9.

At the next page, click on the “FORMAT” button. It may take a few minutes to process your sequence.

10. At the next page, scroll down to the list of proteins that matched your sequence. Choose one that matches one on the list of possible proteins that was given to you. 11. The protein our DNA sequence encodes is (should be in the list provided): _______Presenilin 2___________________________ 12.

Now search www.google.com with the name of your protein to find out the disease your protein is involved in.

12.

This protein is involved in the following disease: _______________Alzheimer’s disease___________________

13. Write a brief paragraph on the next page explaining the disease caused by this protein or a mutation in this protein. Alzheimer’s is a disease that affects many of Americans, especially once getting elderly. The gene is predominately affecting the early onset symptoms for the disease. It is said that the missense mutations are seen within the two different genes. The gene has a wide tissue distribution. With parts of the gene having a mutation it could mean that the symptoms will develop for Alzheimer’s. As of now, the disease has no known treatment because it essentially takes over one’s brain. It slowly eats away at the memory till the point you are no longer able to comprehend what is going on within the world. It is often a very hard thing for families to go through because their loved ones can no longer remember them. Overall, it is a disease that affects a vast majority of Americans, especially elders....