Gene Cloning Revision Notes PDF

Preview

Summary

3 IntroductionThe discovery of the structure and role of DNA and the unravelling of the genetic code has led over the last 50 years to an explosion in our under- standing of organisms and how they work. In the forefront of this revolu- tion came gene cloning. The term “gene cloning” covers a wide ra...

Description

3

Key Tools for Gene Cloning

Learning outcomes: By the end of this chapter you will have an understanding of:

• what gene cloning is • the nature of and need for cloning vectors • what restriction enzymes are and how they can be used to manipulate DNA • the mode of action of DNA ligase and how it is used to join together different fragments of DNA • ways of detecting the presence of cloned DNA in a vector • how PCR can be used to amplify DNA

Copyright © 2007. Taylor & Francis Group. All rights reserved.

3.1 Introduction The discovery of the structure and role of DNA and the unravelling of the genetic code has led over the last 50 years to an explosion in our understanding of organisms and how they work. In the forefront of this revolution came gene cloning. The term “gene cloning” covers a wide range of techniques that make it possible to manipulate DNA in a test tube and also to return it to living organisms where it functions normally. The importance of this technology is that it allows us to isolate any piece of DNA from among the millions of base pairs that make up the genome of an organism. This first step is essential for a whole range of scientific and technological studies, ranging from the study of a gene that is instrumental in causing an inherited disease, to the bioengineering of a strain of yeast that produces a useful pharmaceutical product. Gene cloning involves taking a piece of DNA from the organism where it naturally occurs and putting it into a cloning host such as the bacterium Escherichia coli. It is then possible to study the cloned DNA or produce the protein encoded by the gene. For many applications you may want subsequently to transfer the cloned DNA into another organism, but the initial cloning steps are almost always performed in E. coli.

Minchin, S., Lodge, J., & Lund, P. (2007). Gene cloning. Taylor & Francis Group. Created from bham on 2021-11-28 18:13:41.

36 Gene Cloning

Before looking in detail at how to clone genes, it is important to have an understanding of what the key steps are. DNA is cut into fragments and introduced into a new host, usually E. coli, where it is copied. However, you cannot simply introduce fragments of DNA into a cell or organism as they will probably be degraded, and even if it is not it will not be replicated and passed on when the cell divides. To make sure that the piece of cloned DNA is copied and passed on it is necessary to put it into a vector which will ensure that it is copied every time that the cell copies its own DNA and that a copy is passed on to each daughter cell at cell division. This involves cutting the vector and joining in the piece of DNA that you want to clone. This cutting and joining of DNA fragments is done using enzymes. The new molecule that you have thus created is introduced into your host cell by a process called transformation. Once in the host it will be copied and passed on every time the cell divides making many copies or clones of the original fragment.

3.2 Vectors The most commonly used vectors for gene cloning are plasmids (Section 2.6). Figure 3.1 shows some examples. These are small circular DNA molecules found in many types of bacteria. Plasmids have an “origin of Cla I Hind III Eco RV EcoRI Bam HI Sph I Sall

(a)

Pst I Apr

Tet

(b)

Apr

r

Nru I

pBR322

pUC18

Copyright © 2007. Taylor & Francis Group. All rights reserved.

4363 bps

2686 bps

ori

lacZ' P lac

Pvu II

GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT CTTAAGCTCGAGCCATGGGCCCCTAGGAGATCTCAGCTGGACGTCCGTACGTTCGAA Eco RI

Sst I

Kpn I

SmaI Xmal

Bam HI

Xba l

Sall

Pst I

Sph I

Hind III

Figure 3.1 a) A map of pBR322 showing the positions of the ampicillin resistance (Apr) and tetracycline resistance (Tetr) genes, the origin of replication (ori) and some of the unique restriction enzyme sites. b) A map of pUC18 showing the position of the ampicillin resistance (Apr) gene and the lacZ′ gene; the sequence of the multiple cloning site encoding 10 unique restriction sites is also shown.

Minchin, S., Lodge, J., & Lund, P. (2007). Gene cloning. Taylor & Francis Group. Created from bham on 2021-11-28 18:13:41.

Key Tools for Gene Cloning

replication” which directs the replication of the plasmid and ensures that the cell contains many copies of the plasmid which are distributed between the daughter cells when the cell divides (Box 3.1). The exact number of copies varies according to the particular plasmid. As long as the gene that you have cloned is part of a DNA molecule with an origin of replication, that is, cloned into a plasmid, it will also be copied when the plasmid is copied. There are a number of other features of plasmids that are useful in gene cloning. Naturally occurring plasmids can be quite large: some are more than 100 kb in size, but the ones used in routine gene cloning tend to be less than 10 kb. This makes them easy to purify and to manipulate. Plasmids commonly used in cloning contain a selectable marker, usually an antibiotic resistance gene. This means that you can tell which bacteria contain the plasmid simply by spreading them onto an agar plate containing the antibiotic. Those that contain the plasmid will grow and eventually

Box 3.1 Plasmid Origins of Replication

Copyright © 2007. Taylor & Francis Group. All rights reserved.

Naturally occurring plasmids have been modified by molecular biologists to produce the vectors that we use in gene cloning. Plasmids fall into a number of groups called incompatability groups, depending on where the origin of replication of the plasmids is derived from. Plasmid replication uses many proteins, some encoded by the host bacterium, and some encoded by the plasmid; genes for the latter are often clustered near the origin of replication in the so-called ori region. Sequences in the ori region also control how many copies of the plasmid there are for each copy of the host chromosome. Many of the plasmids used in gene cloning, such as pBR322, are based on the ColE1 origin of replication, so-called because they were originally derived from a plasmid called ColE1. Plasmids based on the ColE1 origin of replication are usually medium copy number plasmids with between 12 and 20 copies of the plasmid per cell. The plasmid pUC18 has the ColE1 origin but also has a mutation in the ori region which disrupts the mechanism that controls the copy number. The consequence of this is that there can be hundreds of copies of pUC18 for each copy of the chromosome. The ColE1 origin of replication only functions in E. coli and closely related species; these plasmids are said to have a narrow host range. Plasmids based on origins which function in a range of organisms are described as broad host range plasmids. The two main examples here are the R (resistance) and the F (fertility) plasmids. In addition to having a broad host range, these plasmids have a low copy number with between two and five copies for the R plasmids and as few as one copy of the F plasmid per copy of the chromosome.

Minchin, S., Lodge, J., & Lund, P. (2007). Gene cloning. Taylor & Francis Group. Created from bham on 2021-11-28 18:13:41.

37

38 Gene Cloning

form a visible colony, and all the cells within that colony will carry copies of the plasmid. Any bacteria that do not contain the plasmid will be killed by the antibiotic, and so cannot give rise to a colony.

Q3.1. If you had a culture of E. coli, some containing only pBR322 and some only pUC18, how would you select only those with pBR322? Q3.2. Name two features of pBR322 that make it useful as a cloning vector.

3.3 Restriction Enzymes If you are going to clone DNA you need a way of cutting it up. While DNA is fairly easy to damage (just shaking a tube containing large DNA molecules will soon reduce them to smaller ones) for gene cloning you need to be able to cut DNA up in a precise and repeatable way. This can be done using enzymes, which are naturally produced by bacteria, and which cut DNA whenever a particular sequence of bases occurs. These are called restriction enzymes or restriction endonucleases, a name that derives from the normal function of these enzymes in the bacteria from which they are isolated (Box 3.2). One of the most commonly used restriction enzymes is

Copyright © 2007. Taylor & Francis Group. All rights reserved.

Box 3.2 Restriction Enzymes The discovery of restriction enzymes arose from work with bacteriophage (viruses which infect bacteria). It had been known since the 1950s that bacteria are more susceptible to infection by bacteriophage which have been grown on the same strain, than bacteriophage which have been grown on another strain. This phenomenon was known as host-controlled restriction, because the bacteriophage was restricted in which host strain it could infect. It was later discovered that this host-controlled restriction was due to the production by the bacterial host of enzymes that degrade phage DNA. These enzymes recognize a specific DNA sequence and cut the DNA at that sequence. The bacterium’s own DNA is protected from being cut by these enzymes by being methylated at the site where the enzyme binds. There are three classes of restriction enzymes, but it is primarily the type II restriction enzymes that are used in gene cloning. These enzymes were called restriction enzymes because they are the enzymes responsible for host-controlled restriction. The DNA sequence they recognize is called a restriction site and the fragments of DNA produced by cutting with these enzymes are called restriction fragments. In 1978 Werner Arber, Hamilton Smith and Daniel Nathans, were awarded a Nobel Prize for the discovery of restriction enzymes and their application to problems of molecular genetics.

Minchin, S., Lodge, J., & Lund, P. (2007). Gene cloning. Taylor & Francis Group. Created from bham on 2021-11-28 18:13:41.

Key Tools for Gene Cloning

Box 3.3 How Do Restriction Enzyme Get Their Names?

Copyright © 2007. Taylor & Francis Group. All rights reserved.

Restriction enzymes are named after the bacteria they are isolated from. EcoRI was isolated from Escherichia coli strain RY13. The first part of the restriction enzyme name is derived from the name of the organism it was isolated from, and it is made up of the first letter of the genus name (E for Escherichia) and the first two letters of the species name (co for coli). This part of the name is usually written in italics or underlined, following the same rules that apply to writing scientific names of bacteria. The rest of the name refers to the strain and if more than one restriction enzyme is isolated from the same strain they are numbered sequentially with roman numerals. This results in a complex name for most restriction enzymes involving a combination of upper and lower case letters, italicization or underlining and roman numerals. Some scientific publications have recently decided not to italicize the first part of the name of restriction enzymes, at the moment this has not been generally accepted; we will use the established nomenclature for restriction enzymes in this book.

produced by the bacterium E. coli; it is called EcoRI (Box 3.3). It cuts DNA whenever the sequence GAATTC occurs. This sequence occurs once in the plasmid pBR322 (Figure 3.1). Have a look at Figure 3.2: there are a number of points that you should notice about the sequence cut by EcoRI. The sequence, which is recognized and cut by the enzyme, is 6 bp long; we say that EcoRI has a six base pair recognition site. This sequence is an inverted repeat. This means if you read the sequence on the top strand from 5′ to 3′ it is the same as the sequence on the bottom strand also read from 5′ to 3′. EcoRI cuts both strands of the DNA and produces a staggered break (Figure 3.2b); this produces sticky or cohesive ends. You will see why this is important when we consider how to join pieces of DNA together. The pieces of DNA produced (a) 5'GACTGGTACTGACTTCATCGAATTCGGGCTACTACCT3' 3'CTGACCATGACTGAAGTAGCTTAAGCCCGATGATGGA 5'

(b) 5'GACTGGTACTGACTTCATCG3' 3'CTGACCATGACTGAAGTAGCTTAA5'

5'

AATTCGGGCTACTACCT3' 3'GCCCGATGATGGA5'

Figure 3.2 a) A section of double stranded DNA showing the EcoRI recognition site; the positions where the enzyme cuts are indicated with arrows. b) The result of cutting of the molecule by the restriction enzyme. Minchin, S., Lodge, J., & Lund, P. (2007). Gene cloning. Taylor & Francis Group. Created from bham on 2021-11-28 18:13:41.

39

40 Gene Cloning

by treatment of DNA with restriction enzymes are often called restriction fragments.

Q3.3. If you have a circular plasmid containing a single EcoRI site, and you cut it with EcoRI, how many pieces of DNA will be formed? What about a circular plasmid containing two EcoRI sites? What about a linear piece of DNA, containing one EcoRI site? Many bacteria have been examined for the presence of restriction enzymes and a large number of these enzymes have been isolated. They have a range of different properties, and recognize a wide variety of different sequences, many of which are useful in gene cloning. We shall examine some key restriction enzymes in more detail after we have considered how to join DNA molecules together.

Copyright © 2007. Taylor & Francis Group. All rights reserved.

3.4 DNA Ligase Having described a way of cutting DNA molecules up we now need to consider how to join them together in a new combination. The new molecule is called a recombinant. If the DNA has been cut up using a restriction enzyme like EcoRI, which produces sticky ends, then when two molecules with the same sticky ends come into contact, hydrogen bonding between the complementary bases will cause the molecules to stick together. This is in fact why these molecules are said to have sticky ends. This is not a very stable arrangement and the two molecules will soon drift apart again. For gene cloning, you need to be able to covalently link the two molecules. The enzyme that is capable of doing this is called DNA ligase. When two restriction fragments with sticky ends are transiently held together by hydrogen bonding there are in effect two single-stranded breaks in a double-stranded molecule (Figure 3.3); DNA ligase repairs these single-stranded breaks. DNA ligase catalyzes the formation of a covalent phosphodiester bond between the 5′ phosphate on one DNA strand and a 3′ hydroxyl on another. This process requires energy. The most commonly used DNA ligase is a protein produced by a bacteriophage (a virus that infects bacteria) called T4. It uses ATP as an energy source. A basic cloning experiment involving the cloning of genomic DNA fragments into the plasmid vector pBR322 is outlined in Figure 3.4. The first step is to cut the plasmid vector at a unique restriction site; this will produce a linear molecule. The genomic DNA, from which a fragment is to be cloned, is also cut with the same restriction enzyme to produce linear fragments, which will be of many different sizes depending on where the EcoRI sites occur in the DNA. After inactivating the restriction enzymes, the plasmid and restriction enzyme fragments are mixed in the presence of T4 DNA ligase. As shown in Figure 3.4, several possible events can occur in this

Minchin, S., Lodge, J., & Lund, P. (2007). Gene cloning. Taylor & Francis Group. Created from bham on 2021-11-28 18:13:41.

Key Tools for Gene Cloning

(a)

H O

P

5'GACTGGTACTGACTTCATCG3'

||||||||||||||||||||

3'CTGACCATGACTGAAGTAGCTTAA5'

P (b)

AATTCGGGCTACTACCT3' ||||||||||||| 3'GCCCGATGATGGA5'

5'

O H

H O P 5'GACTGGTACTGACTTCATCG AATT CGGGCTACTACCT3'

|||||||||||||||||||| |||| |||||||||||||

3'CTGACCATGACTGAAGTAGC TTAA GCCCGATGATGGA5'

(c)

P O H 5'GACTGGTACTGACTTCATCGAATT CGGGCTACTACCT3'

|||||||||||||||||||||||| |||||||||||||

3'CTGACCATGACTGAAGTAGCTTAA GCCCGATGATGGA5'

PO H

Copyright © 2007. Taylor & Francis Group. All rights reserved.

Figure 3.3 a) Two DNA molecules with sticky ends generated by cutting with EcoRI, the bases making up the EcoRI restriction site are indicated in blue. b) Hydrogen bonding between complementary bases causes the molecules, transiently, to stick together. DNA ligase (indicated by gray shading) catalyzes the formation of a phosphodiester bond between the 5′ phosphate on one molecule and the 3′ hydroxyl on the other. c) The two molecules are now covalently linked by the top strand. The nick in the bottom strand may also be sealed by DNA ligase, or may be repaired by the host bacterium.

mixture. Any molecule with an EcoRI sticky end can anneal to any other molecule with the same sticky end, so many fragments of genomic DNA will anneal to each other, in random order. However, these molecules will have neither an origin of replication nor an antibiotic resistance marker and so even if they can be introduced into E. coli, they will not lead to the formation of a colony. Another possibility is that the ends of the vector molecules may anneal with each other either reforming the original plasmid (Figure 3.4d) or forming larger molecules with more than one copy of the plasmid. A third possibility, that one vector molecule will be joined to one of the genomic DNA fragments and will circularize to form a new recombinant molecule, is the desired outcome from the cloning experiment (Figure 3.4c). It is possible to arrange the conditions in the ligation reaction so that the likelihood of the formation of such a recombinant molecule is favored. In a dilute solution, the chances of the two ends of the vector molecule coming into contact with each other are higher than the chances of an interaction between two different molecules. Ligation reactions are carried out at high DNA concentrations, typically with a molar ratio of 3:1 of insert to vector (i.e. three times as many insert molecules as

Minchin, S., Lodge, J., & Lund, P. (2007). Gene cloning. Taylor & Francis Group. Created from bham on 2021-11-28 18:13:41.

41

42 Gene Cloning

(a)

(b)

(c)

Eco RI Apr Tet r pBR222

Apr Tet r

Apr Tet r

(d) Apr

Tet r

(e)

Cut with Eco RI

Mix and ligate

Copyright © 2007. Taylor & Francis Group. All rights reserved.

Figure 3.4 A basic cloning experiment designed to clone genomic DNA into the vector pBR222, shown uncut in a). The vector DNA is cut with EcoRI into a single linear fragment, the genomic DNA is also cut with EcoRI producing a range of fragments (shown in b)). These are mixed and DNA ligase is used to join them together. There are several possible types of recombinant molecule that can result from this. A fragment of genomic DNA can be successfully cloned into the EcoRI site in the vector c); this is the desired outcome. Alternatively, the sticky ends of the vector may be rejoined without any genomic DNA insert d), or the genomic DNA fragments may be joined together in a random order e). Only products containing the vector will be able to form colonies on selective media; those containing the vector alone may be distinguished from those containing vector plus insert by further analysis of the size of the plasmid and presence of the insert.

vector molecules), to increase the likelihood of the correct recombinant being formed.

Q3.4. In ...