Mitochondrial DNA Variation in Mauritania and Mali and their Genetic Relationship to Other Western Africa Populations PDF

Preview

Summary

doi: 10.1111/j.1469-1809.2006.00259.x Mitochondrial DNA Variation in Mauritania and Mali and their Genetic Relationship to Other Western Africa Populations A. M. Gonzalez ´ 1,∗ , V. M. Cabrera1 , J. M. Larruga1 , A. Tounkara2 , G. Noumsi2 , B. N. Thomas3 and J. M. Moulds4 1 Universidad de La Laguna,...

Description

doi: 10.1111/j.1469-1809.2006.00259.x

Mitochondrial DNA Variation in Mauritania and Mali and their Genetic Relationship to Other Western Africa Populations ´ 1,∗ , V. M. Cabrera1 , J. M. Larruga1 , A. Tounkara2 , G. Noumsi2 , B. N. Thomas3 A. M. Gonzalez and J. M. Moulds4 1 Universidad de La Laguna, Tenerife, Spain 2 Centr´e National de Transfusion Sanguine, Bamako, Mali 3 University of Pennsylvania, Philadelphia, PA 4 LifeShare Blood Centers, Shreveport, LA

Summary Mitochondrial DNA (mtDNA) variation was analyzed in Mauritania and Mali, and compared to other West African samples covering the considerable geographic, ethnic and linguistic diversity of this region. The Mauritanian mtDNA profile shows that 55% of their lineages have a west Eurasian provenance, with the U6 cluster (17%) being the best represented. Only 6% of the sub-Saharan sequences belong to the L3A haplogroup a frequency similar to other Berber speaking groups but significantly different to the Arabic speaking North Africans. The historic Arab slave trade may be the main cause of this difference. Only one HV west Eurasian lineage has been detected in Mali but 40% of the sub-Saharan sequences belong to cluster L3A. The presence of L0a representatives demonstrates gene flow from eastern regions. Although both groups speak related dialects of the Mande branch, significant genetic differences exist between the Bambara and Malinke groups. The West African genetic variation is well structured by geography and language, but more detailed ethnolinguistic clustering suggest that geography is the main factor responsible for this differentiation. Keywords: Mali, Mauritania, mitochondrial DNA, Human populations

Introduction West Africa encompasses considerable geographic, ethnic and linguistic diversity. From north to south three successive bands known as the Sahel, the Sudan and the Guinea move from the desert through the savannah to the moist forest. Past climatic fluctuations modified the transition borders widely, forcing people to migrate and to re-adapt to new places. Very little is known of the Prehistory of West Africa, although in open lands, some signs of an early North African Aterian influence has been detected. However, since 12,000 ∗ Corresponding author: A.M. Gonz´alez, Genetics, Biology, University of La Laguna, 38271 Tenerife, Canary Islands, Spain, Tel.: 34-922-31 83-50, Fax: 34-922-31-83-11, E-mail: [email protected].  C

2006 The Authors C 2006 University College London Journal compilation 

ya two regional tool-making traditions have been discerned. A non-microlithic culture related to the Pygmies is detectable on the Guinea fringe, and a more elaborate microlithic industry, associated with tall and slender Negroid types, appeared in the Sahel and Sudan bands (Newman, 1995). Agriculture and herding came to the area around the third millennium BC. West Africa may have been the first part of the continent to experience an important population increase from farming (Cavalli-Sforza et al. 1994). Demographic increase and posterior cultural advances such as those involving iron may have contributed to the rise of the historic West African empires of Ghana, Mali and Songhay (Newman, 1995). Two of the four African language phyla are present in West Africa. Afroasiatic, with its Berber and Chadic branches, covers the Sahara-Sahel, Annals of Human Genetics (2006) 70,631–657

631

´ A. M. Gonzalez et al.

and the Niger-Congo with its Atlantic, Mande, Kwa and Voltaic branches spreads into the Sudan and Guinea bands. These branches further split into hundreds of dialects spoken by different ethnic groups. From this summarized geographic, archaeological and linguistic information it can be deduced that, undoubtedly, geographic constraints played a major role in this ethnic and linguistic fragmentation, but that focalised cultural improvements allowed better adaptation and, consequently, demographic growth and expansions. From a population genetics perspective it is crucial to determine if the levels of gene flow that accompanied those cultural advances were sufficient to homogenize the interpopulation genetic variation accumulated by geographic isolation. Genetically, the area has been only moderately studied. Based on classical markers at least two independent demic expansions have been proposed; one in western Senegal and one in the Niger-Mali-Burkina Faso region (Cavalli-Sforza et al. 1994). At the molecular level studies have concentrated on mitochondrial DNA (mtDNA), a locus that shows distinct geographic patterns in Africa (Watson et al. 1997; Salas et al. 2002), but have mainly focused on specific countries such as Senegal (Graven et al. 1995; Rando et al. 1998), NigerNigeria (Watson et al. 1997), Guinea-Bissau (Rosa et al. 2004), Cameroon (Coia et al. 2005) or Sierra Leone (Jackson et al. 2005). In the present article we add to the mitochondrial information from this area by analyzing HVSI/II sequences and RFLP typing 64 Maure from Mauritania and 124 samples from different ethnolinguistic groups from Mali. This information, together with the available data from the aforementioned West African countries, has been used to assess the relative importance that physical and cultural factors such as geography and language have had on the genetic structure of the region.

Material and Methods Samples Buccal swabs or blood samples were obtained from 188 unrelated west African individuals, 64 Maure from Mauritania, including 30 previously published (Rando et al. 1988) that have been RFLP analyzed and reclassified (Table 1), and 124 subjects from different ethnolinguis632

Annals of Human Genetics (2006) 70,631–657

tic groups in Mali (Table 2). Appropriate informed consent to anonymously use their data was obtained from all the individuals sampled. The following available samples from other west African countries (Figure 1 and Appendix I) have also been used for population comparisons: Senegal 240 (Graven et al. 1995; Rando et al. 1998); Guinea Bissau 372 (Rosa et al. 2004); Sierra Leone 277 (Jackson et al. 2005); Niger-Nigeria 160 (Watson et al. 1997); Cameroon 441 (Destro-Bisol et al. 2004; Coia et al. 2005).

Sequencing of mtDNA For Maure total DNA, either from buccal swabs or blood samples, was isolated following a fast alkaline method (Rudbeck & Dissing, 1998). For Mali, blood samples were obtained from random blood donors who identified their ethnicity. DNA was extracted using the Gentra PureGene kit (Minneapolis, MN). Hypervariable segment I (HVSI) and Hypervariable segment II (HVSII) of the mitochondrial control region were amplified by PCR using primer pairs HV1 (L15840: 5 ACTTCACAACAATCCTAATCCT 3 )/HV2(H16436: 5 CggAgCgAggAgAgTAgCAC 3 ) and L16340/H945 (Maca-Meyer et al. 2001), respectively. Amplified products were sequenced for both complementary strands with the Big Dye Terminator Cycle sequencing kit (Applied Biosystems). Sequencing reactions were analyzed on an Applied Biosystems 3100 DNA analyzer.

Haplotype Classification and RFLP Typing Sequences were aligned with the Cambridge Reference Sequence (CRS) using CLUSTAL and mutations identified by the three last digits of their positions in the reference sequence (Anderson et al. 1981). For transversions the variant base is specified by an additional letter. The haplotypes obtained were sorted into mtDNA haplogroups following, with minor modifications, the nomenclature proposed in Salas et al. (2002) and actualized in Kivisild et al. (2004). In cases of ambiguous sequence assignation additional RFLP analyses were carried out, as detailed in Tables 1 and 2. To homogenize the data the other published sequences used in the  C 2006 The Authors C 2006 University College London Journal compilation 

 C

CRS (H/HV/U/R) CRS CRS CRS 519 H/HV/U/R – CRS 172 207 291 145 222 174 311 234 235 278 311 preHV 126 362 126 304 362 V 298 153 298 U5 270 U5b 189 270 189 192 270 U6a 172 219 278 092 172 219 278 172 219 278 290 311 U6a1 172 189 219 278 K 224 311 093 224 311 J 069 126 225 069 126 295 L3b 124 223 278 362 519 111 124 223 278 362

HVIa

2006 The Authors C 2006 University College London Journal compilation  73 263 311.1 514dCA

73 150 152 263 303.1 311.1

263 311.1

HVII

Table 1 HVI and HVII sequences and RFLPs in Mauritanians

+ +

7 1 s

− −

9 0 5 2 n

9 0 7 0 l

+

1 1 0 0 1 n

+

−

−

−

1 2 3 0 8 g

1 2 8 1 0 k

+ −

1 5 9 0 4 u

1 2

1

1 1

1 1

1 1 1 1 1 1∗ 1

1 1 2 1

b

1 1∗

1∗ 1∗

1 2

3

7 0 5 5 a

+

+

+ +

− − − − − + −

− −

+

7 0 2 5 a

6 1 1

− +

4 5 7 7 q

+ + +

−

3 3 4 8 d

mtDNA Variation in Mauritania and Mali

Annals of Human Genetics (2006) 70,631–657

633

634

Annals of Human Genetics (2006) 70,631–657 73 150 152 182 195 198 263 303.1 311.1 325 513 514dCA 680 709 769

73 151 152 182 186A 189C 247 263 311.1 316 514dCA 769 825A

73 152 182 185T 195 247 263 311.1 354 514dCA 709 769 825A

HVII

7 1 s

3 3 4 8 d

4 5 7 7 q

7 0 2 5 a

+

7 0 5 5 a

9 0 5 2 n

+

9 0 7 0 l

b

a

HVI nucleotide positions are − 16000 Haplotypes only present in Mauritania are asterisk marked Restriction sites are indicated as follows: a = Alu I, d = Nde II, g = Hinf I, k = Rsa I, l = Taq I, n= Hae II, s = Sph I, u = Mse I

L2a1 223 278 294 309 390 051 223 278 294 309 390 189 223 278 294 309 390 051 223 278 294 305T 309 390 129 223 278 294 309 342 390 L2a1beta3 189 192 223 278 294 309 390 L2b1 086 114A 129 213 223 278 362 390 Total

L2c 223 278 390 519

086 126 187 189 223 264 270 278 293 311 093 126 187 189 223 264 270 278 293 311 126 145 187 189 223 264 270 278 293 311 L1c∗ 129 189 223 278 294 311 360 519

L3b1 051 223 265C 278 318 362 L3e4 051 153 223 264 L1b 126 187 189 223 239 270 278 311 L1b1 126 187 189 223 264 278 293 311 187 189 223 264 270 278 293 311 126 187 189 223 264 270 278 293 311

HVIa

Table 1 Continued 1 1 0 0 1 n

1 2 3 0 8 g

+

1 2 8 1 0 k

1 5 9 0 4 u

1∗ 64

2

2 1 1 1∗ 1∗

1

2∗

3 1 1

1 1 4

1∗

1∗

1∗

b

´ A. M. Gonzalez et al.

 C 2006 The Authors C 2006 University College London Journal compilation 

 C

HV (+7025AluI, −14766MseI) 15898 222 311 L3b (15940dT) 15940dT 124 223 278 362 15940dT 124 223 278 362 519 15940dT 124 223 278 362 519 15940dT 124 278 355 362 527 15940dT 093 124 223 278 362 519 15940dT 093 124 223 278 362 527 15940dT 051 124 183C 189 223 278 362 15940dT 124 209 223 278 362 384 15940dT 124 223 278 291 362 519 15916 15940dT 124 223 278 355 362 527 15940dT 124 145 182C 183C 189 223 278 362 15940dT 124 156 176 223 278 362 519 15940dT 093 124 182C 183C 189 223 270 278 294 362 L3b1 15940dT 223 278 362 15940dT 223 278 362 519 15940dT 223 278 362 519 15940dT 093 223 278 362 519 15940dT 223 234 278 362 519 15940dT 051 223 278 318 362 519 15940dT 093 223 234 278 362 519 L3d (−8616MboI, −10084TaqI, 921) 124 223 124 223 399 124 166 223 124 183C 189 223 399 124 223 286A 519 124 223 325 399 L3d2 124 223 256 124 223 256 124 223 256 355 L3d3 124 183C 189 223 278 304 311

HVIa,c

Table 2 HVI and HVII sequences and RFLPs in Mali

2006 The Authors C 2006 University College London Journal compilation 

73 151 152 263 303.1 311.1 750 921

73 146 263 303.1 311.1 514dCA 574 750 921 73 146 152 263 311.1 514dCA 750 921 73 146 152 263 311.1 514dCA 750 921

73 152 263 311.1 514dCA 709 750 921 73 150 263 311.1 514dCA 750 851 921 73 152 263 311.1 514dCA 750 921 73 150 152 263 311.1 514dCA 750 921 73 150 152 263 303.1 311.1 514dCA 750 921 73 150 152 263 303.1 311.1 514dCA 750 921

73 263 303.1 311.1 514dCA 750 35 73 263 311.1 514dCA 750 73 263 311.1 514dCA 750 73 263 311.1 514dCA 750 73 263 311.1 514dCA 750 73 261 263 311.1 514dCA 750 73 263 311.1 514dCA 750

1

1

1

1

1

1

1 1

1 1

1 1 1

1 1 1 1 1

1

1

1

Bab

73 249iA 263 311.1 514dCA 750 73 263 311.1 514dCA 750 73 151 152 263 311.1 514dCA 544G 750 73 263 311.1 514dCA 750 73 263 303.1 311.1 514dCA 750 73 263 311.1 514dCA 750 73 152 263 311.1 514dCA 750 73 263 303.1 311.1 514dCA 750 73 195 263 311.1 514dCA 750 73 263 311.1 514dCA 750 73 263 311.1 514dCA 750 73 263 311.1 514dCA 750 73 263 303.1 311.1 514dCA 750

Bob 1

1

Mal

263 303.1 311.1 509 750

HVII

1

Dog

Tua

1

1

Son

1

1 1 1

1

Peu

Sen

1

Sok

?

1

1 1 1∗

1 1 1 1 1∗ 1∗

1 1 1 1 2∗ 1 1∗

1 1 1 1∗ 1 1 1 1∗ 1 1 1 1∗ 1∗

1∗

Malib

mtDNA Variation in Mauritania and Mali

Annals of Human Genetics (2006) 70,631–657

635

636

Annals of Human Genetics (2006) 70,631–657

60 61 64 73 150 195 263 311.1 514dCA 620dT 750 73 150 152 195 263 311.1 750 73 150 152 195 263 311.1 514dCA 750 73 150 195 263 303.1 311.1 750 73 150 195 263 311.1 514dCA 750 73 114 150 195 263 303.1 311.1 750 73 150 195 263 303.1 311.1 750

1

1

1

1

1

1

Bab

73 150 195 263 303.1 311.1 750 73 150 189 195 198 263 311.1 750 73 150 195 198 263 311.1 750 73 150 263 311.1 750 1

Bob 1

1

Mal

73 150 189 200 263 311.1 750

HVII

172 183C 184iC 187 189 223 320 519 172 183C 189 223 259 320 519 L3e3 (+2349MboI,+5260AvaII, 195, 750) 214 223 265T 311 73 150 195 263 303.1 311.1 514dCA L3e4 (+2349MboI, +5260AvaII, 750) 051 223 264 519 73 150 263 311.1 514dCA L3e5 (+2349MboI, 398) 041 223 355 519 73 150 263 311.1 398 514dCA 750 L3f (15940dT, 189, 200) 15940dT 129 209 223 311 73 189 200 263 303.1 311.1 750 519 L3f1 15940dT 209 223 292 311 73 150 189 200 263 750 761 519

172 183C 189 223 320 519 172 183C 189 223 320 519

172 183C 189 223 320 519 172 183C 189 223 320 519

148 223 320 519 184iC 189 192 278 320 L3e2b (+2349MboI) 172 189 223 320 519

L3e1(15942, 189, 200) 15942 172 223 327 399 L3e2 (+2349MboI) 15927C 223 320 519 15924 223 320 519

HVIa

Table 2 Continued

1

Dog

Tua

1

1

Son

1

1

1

1

Peu

Sen

1 1

Sok

?

1

1

1

1

1∗

1∗

1

1 1

1 1

1

1∗ 1∗

2 1

1

Malib

´ A. M. Gonzalez et al.

 C 2006 The Authors C 2006 University College London Journal compilation 

 C

64 93 152 185 189 236 247 263 311.1 514dCA 574 750 769 825A

HVII

64 93 185 189 195 200 236 247 263 311.1 514dCA 750 769 825A 129 148 168 172 187 188G 64 93 152 185 189 200 236 247 189 223 230 241 311 320 263 303.1 311.1 514dCA 750 519 769 825A L1b (−7055AluI, 185T, 357, 709, 710) 126 187 189 223 264 270 73 150 152 182 185T 189 195 278 311 519 247 263 311.1 357 514dCA 709 710 750 769 825A 126 187 189 223 264 270 73 152 182 185T 195 247 263 278 311 519 311.1 357 514dCA 709 710 750 769 825A 126 187 189 223 264 270 73 152 182 185T 189 195 247 278 311 519 263 303.1 311.1 357 514dCA 709 710 750 769 825A 111 126 187 189 223 239 73 146 152 263 303.1 311.1 357 270 278 311 514dCA 709 710 750 769 825A 126 187 189 223 239 264 73 152 182 185T 189 247 263 270 278 311 519 311.1 357 514dCA 709 710 750 769 825A L1b1 (−7055AluI, 185T, 357, 709, 710) 126 187 189 223 264 270 73 151 152 182 185T 189 195 278 293 311 247 263 311.1 357 514dCA 709 710 750 769 825A 126 187 189 223 264 270 73 151 152 182 185T 189 195 278 293 311 399 247 263 311.1 357 514dCA 709 710 750 769 825A 126 187 189 223 264 270 73 94 152 182 185T 195 247 263 278 293 311 519 311.1 357 514dCA 709 710 750 769 825A

L0a∗ (73, 93, 189, 236) 129 148 168 172 187 188G 189 223 230 293 311 320 519 L0a1 129 148 168 172 187 188G 189 223 230 311 320

HVIa

Table 2 Continued Tua

Son

1

Peu

Sen

Sok

1

?

1

1

Malib

2006 The Authors C 2006 University College London Journal compilation 

1

1

1

1

1

1

1

1

1

1

1

1

Dog

1

1

1

Bab

1∗

1

Bob

1

Mal

mtDNA Variation in Mauritania and Mali

Annals of Human Genetics (2006) 70,631–657

637

638 HVII

73 146 152 182 185T 189 195 247 263 303.1 311.1 357 514dCA 709 710 750 769 825A 126 187 189 223 264 270 73 152 182 185T 195 247 263 278 293 311 519 286dA 311.1 357 514dCA 709 710 750 769 825A 126 187 189 223 264 270 73 152 182 185T 247 263 303.1 278 293 311 519 311.1 357 514dCA 709 710 723 750 769 825A 093 126 187 189 223 264 73 152 182 185T 195 247 263 270 278 293 311 519 311.1 357 514dCA 709 710 750 769 825A 114G 126 187 189 223 264 73 152 182 185T 195 247 263 270 278 293 311 519 303.1 311.1 357 514dCA 709 710 750 769 825A 126 187 189 223 264 270 73 152 182 185T 195 247 263 278 293 311 318 519 311.1 357 514dCA 709 710 750 769 825A L1c1a (151, 186A, 189C, 297, 316) 15941 093 129 187 189 223 73 151 152 182 186A 189C 247 261 274 278 311 360 519 263 291T 297 311.1 316 514dCA 750 769 825A L1c3a1 (15905, 15978, 151, 186A, 189C, 316) 15905 15978 129 183C 189 73 151 152 182 186A 189C 247 215 223 278 294 311 360 263 311.1 316 514dCA 516 519 750 769 825A 15905 15978 093 129 183C 73 151 152 182 186A 189C 247 189 215 223 278 294 311 263 297T 311.1 316 514dCA 360 519 750 769 772 825A L1c3b1 (15905, 15978, 186A, 189C, 316, 629) 15905 15978 017 129 163 73 152 182 186A 189C 247 263 187 189 223 278 293 294 311.1 316 514dCA 629 750 311 360 519 769 825A 73 152 182 186A 189C 247 263 15905 15978 15998 017 311.1 316 514dCA 629 750 129 163 187 189 223 278 769 825A 293 294 311 360 519

126 187 189 223 264 270 278 293 311 519

HVIa

Table 2 Continued

Annals of Human Genetics (2006) 70,631–657

1

1

Mal

Bob

1∗

1∗

1

1

1

1

1

Malib

1

?

1

Sok

1

Sen

1

1

Peu

1

Son

1

1

Tua

1

Dog

...