Molecular cloning lab PDF

Preview

Summary

Lab assignment on molecular cloning with videos to watch...

Description

Online learning resources: Bacterial Transformation https://www.youtube.com/watch?v=c40UudFIlGw

Key Steps of Molecular Cloning https://www.youtube.com/watch?v=sjwNtQYLKeU

Gene cloning https://www.youtube.com/watch?v=3YRjpiBqSU4

DNA cloning and recombinant DNA https://www.youtube.com/watch?v=5ffl-0OYVQU

Read Molecular cloning Lab 1 ANSWER SHEET EXERCISE: Restriction endonucleases in cloning (40pts for this section) 1) A friend plans to use EcoRI to insert a gene into a plasmid. He then plans to grow the plasmid in Escherichia coli strain R. He asks you to evaluate his plan. How do you respond? (10pt)  I would tell my friend that his plan appears to be a sufficient plan. Growing the E.Coli with the R strain I believe would show growth because they are resistant to the antibody.

2) Another friend plans to use EcoRI to insert a gene into a plasmid. She tells you that the sequence of the gene that she is interested in cloning is: 3’ATCCGATTCGTAGATGATCGATTCAACTCTCTCAGCTTAAGGCAT 5’ She asks you to evaluate her plan. How do you respond? (10pt) 

Since CTTAG is where the recognition site is for EcoRI and this short sequence is found within the sequence of the gene that she found the sequence can be used so this is a good plan.

3) Ampicillin is a bacteriostatic antibiotic. (Instead of killing bacteria, it inhibits their growth.) Ramon plated bacteria transformed with a plasmid that confers ampicillin resistance. He plated the bacteria on Thursday and left them in a 37 oC incubator overnight. On Friday, he observed moderately sized bacterial colonies. He decide to leave them in the incubator a little longer before picking the colonies that he wanted to work with further. Unfortunately, he forgot about the plate and left it in the incubator over the weekend. On Monday, his plate had large colonies that were each surrounded by very small colonies. A) Interpret and explain Ramon’s observations. (5pt)



The moderately sized colonies viewed on Friday are the ampicillin resistant colonies. After a couple of days the new large colonies are the growth of the ampicillin colonies and the smaller ones surrounding them are colonies without the plasmid just beginning to grow.

B) Predict what he will find when he picks some large and some small colonies and follows the plasmid isolation protocol for each of the colonies. (5pt) 

Since the enzyme that activates the resistance of ampicillin is a secreted enzyme after being left in the incubator over the weekend it will secrete onto the agar causing the ampicillin to be inactivated. Once this happens the new colonies that form around the large ampicillin resistant colonies will grow although they are not resistant due to the inactivation of the ampicillin

4) A 9 kb plasmid has restriction sites for both EcoRI and HindIII. Use the gel shown below to build a restriction map for this plasmid. The label at the top of each lane

indicates the enzymes used to digest the plasmid for that sample. (10pt)

3-------2--------4-----------3 Hind III 0.3----1.7-----2.8-------3 EcoRI + Hind III 2.25----4.5-----------2.25 EcoRI Read Molecular cloning Lab 2 Lesson 2 Review (30pt for this section)

Before collecting data and analyzing your results answer the following questions. 1. Describe the steps of a bacterial transformation (10pts) -Bacteria are prepared by stripping the cell wall - The bacteria are mixed with plasmid solution -bacteria are exposed to heat or electrical shock causing holes -plasmids enters the cytoplasm -bacteria taken back to regular environment, holes close, and bacteria grow/divide

2. On which of the plates would you expect to find bacteria most like the original nontransformed E. coli colonies you initially observed? Explain your predictions. (5pt) 

On the negative control plate because they have the noncompetent cells meaning they do not contain the foreign DNA.

3. If there are any genetically transformed bacterial cells, on which plate(s) would they most likely be located? Explain your predictions. (5pt) -On the plates containing the nutrient and the ampicillin since they contain the ampicillin resistance

4. Which plates should be compared to determine if any genetic transformation has occurred? Why? (5pt) 

The experimental plate and the control plate should be compared. This is because the control plate should not show any growth since it is not resistant to the ampicillin present on the medium. On the other hand, the experimental plate should show growth because the transformed cells should be ampicillin resistant resulting in growth on the medium. In comparing these plates would indicate transformation of ampicillin resistance gene was effective.

5. What is meant by a control plate? What purpose does a control serve? (5pt) 

The control plate is the plate in which the condition being studied is not added to the plate. The purpose of the control is to serve as a template to compare the experimental results to.

Read Molecular cloning Lab 3 ANSWER SHEET FOR EXERCISE 8: Analysis of mRNA Expression using RT- PCR (30pt for this section)

1. Compare and contrast PCR to the steps of in vivo DNA replication. (10pt) -For DNA replication DNA is separated using helicase while for PCR, the DNA is separated by heat denaturation. Also, DNA replication has leading and lagging strand synthesis.

2. As stated in the Introduction section, dNTPs are required for PCR. What is the purpose of dNTPs? (5pt) -Synthesis of new DNA

3. How do Primers aid in DNA amplification during PCR? (5pt) -Primers are used to designate the piece of DNA needed to be amplified

o 4. Why do we use 72 C as the elongation temperature in the PCR reaction? (Hint: it has something to do with the enzyme). (5pt) -This temperature is the optimum temperature for Taq polymerase which is necessary for the elongation process of PCR

5. Each PCR reaction is specific for the target DNA you wish to amplify. Thus, it is often necessary to “optimize” a PCR protocol for each target. Review the procedure from the lab manual and state any points which could be adjusted to improve results. (5pt) *I ncr easi ngt hec ycl enumberf orPCRsot hatt henumberofDNAc opi espr oducedwoul di ncr easecoul d pot ent i al l yi mpr ov et her esul t s...