Tutorial three. PDF

Preview

Summary

workshop...

Description

[BIO394 GENETIC ENGINEERING PCR AMPLIFICATION AND PRIMER DESIGN] WEEK 4 WORKSHOP 3 Student name: Student number: AIM: THE PURPOSE OF THIS WORKSHEET IS TO FAMILIARISE YOU WITH THE PROCESS OF USING GENEIOUS TO DESIGN PRIMERS FOR AMPLIFICATION OF THE TARGET GENES IN YOUR LABORATORY PROJECT

WORKFLOW: By performing the tasks in this worksheet you will be able to: 1) 2) 3) 4) 5) 6) 7)

8) 9)

IMPORT A SEQUENCED GENOME from a database into Geneious SELECT A TARGET GENE within this sequence SELECT PRIMER PARAMETERS for use in a Phusion PCR reaction DESIGN PRIMERS for the upstream (UR-F and UR-R) and downstream regions (DR-F and DR-R) of the target gene. ENSURE THERE ARE NO RESTRICTION SITES IN THE PRODUCTS FOR THE ENZYMES YOU WILL BE USING FOR CLONING (XhoI, SacI, HindIII and XbaI). (Why is this important?) ADD APPROPRIATE TAGS; add restriction enzyme sites and TAATAA tags to your primers (for cloning and to maintain Tm of the primers) EXTRACT OUT THE AMPLIFICATION PRODUCT SEQUENCES and save them in a separate folder. Now determine the amplification product size. These sequences will be used to construct your inactivation vectors for your laboratory project; to be done in the next Workshop) CALCULATE THE TM OF YOUR PRIMERS GENERATE ALL OF THE PRIMER PAIRS REQUIRED for the genes we are targeting for knockout in NGR234 in your own time. Add this information to the Workshop 3 PCR Amplification assignment table. The final completed table needs to be submitted by COB Friday of WEEK 6. This will constitute 10% of your final mark.

OVERVIEW: Your BIO394 Laboratory Project In the previous workshops, we have been constructing plasmids as part of the process to build an inactivation vector to knock out target genes in the bacterium Rhizobium sp. NGR234 (Figure 1) (This is your BIO394 laboratory project). In the previous workshops, you have constructed in silico the suicidal plasmid pJQ200KS (Workshop 1) and the plasmid pRTGNm2 (Workshop 2) which is the source of the CAS-GNm cassette (Figure 1). For the next stage of constructing an inactivation vector, we need to obtain PCR amplification fragments of the upstream and downstream regions of the target gene(s) of Rhizobium sp. NGR234. These will be used in a quadruple fragment cloning procedure to construct the inactivation vector (Figure 1). In order to do this we will need to design primers to amplify these upstream and downstream fragments. Because we are using directional cloning, we also need to add restriction enzyme sites.

Murdoch University

1

[BIO394 GENETIC ENGINEERING PCR AMPLIFICATION AND PRIMER DESIGN] WEEK 4 WORKSHOP 3 The primer design, amplification of the upstream and downstream fragments and construction of the inactivation vector can all be done in silico in Geneious. Step 1 involves importing the sequenced genome of Rhizobium sp. NGR234 into Geneious and finding the target genes. Figure 1. Overview of the BIO394 laboratory project.

Murdoch University

2

[BIO394 GENETIC ENGINEERING PCR AMPLIFICATION AND PRIMER DESIGN] WEEK 4 WORKSHOP 3 TASKS: 1)

Import the complete genome sequence of Rhizobium sp. NGR234 into Geneious. For this exercise we will import the NGR234 genome from the NCBI database. In the Geneious local directory, create a “BIO394 WS3” subfolder, then within this folder create a “NGR234 NCBI genome” folder. In the Geneious Source panel, move down to “NCBI” and select “Genome”. In the search bar type in NGR234 and click on search. A number of hits will return. Select only the 3 files that contain the term “Sinorhizobium fredii NGR234”. Notice that the organism has been designated as “Sinorhizobium fredii NGR234” in NCBI and has yet to be reclassified according to the latest taxonomy. Drag and Drop the 3 selected genome files into the “NGR234 NCBI genome” folder you have created in the local directory in Geneious. You will then need to select the 3 files in this folder and click on the Download bar in the “Document Summaries” window to retrieve the full information. This may take a little while to download.

2)

Select a target gene within the NGR234 sequence. In the laboratory, we will be inactivating three genes (see Table below) that encode enzymes in a pathway that modifies tRNA with queuosine. To inactivate a gene we need to amplify an upstream Region (UR) and a Downstream Region (DR) and ligate this with an antibiotic cassette and a suicidal vector (See Figure 1). Hence, we need to design primers to amplify the required regions for each target gene. Let’s start with the queG locus tag NGR_c36640 (the locus tag is a unique number that is given to each gene within the genome). In this case the “c” in NGR_c36640 indicates that this gene is present on the chromosome of NGR234). You will need to apply the process to each of the genes targeted. In Geneious, select all 3 files and use the “Find in Document” command to look for the locus tag NGR_c36640. Make sure the box next to “In Annotations” is selected when performing the search. Note: in this particular case, the gene will be located on the chromosome scaffold (NC_012587; 3,925,702 bp). Notice that this gene has already been given the gene symbol “queG”. However, some of the other genes you will work with will not be annotated. You will need to annotate all the genes in the following table. To do this, click on “Allow Editing” for a gene annotation and then select “Edit Annotation”. Next to “Name” in the popup window type the gene symbol name as shown in the table below and then click “OK”. Make sure they are all annotated correctly. Locus tag NGR_c36640 NGR_b18180 NGR_b18170

Gene symbol should be annotated as queG queC queD Murdoch University

3

[BIO394 GENETIC ENGINEERING PCR AMPLIFICATION AND PRIMER DESIGN] WEEK 4 WORKSHOP 3 NGR_b18160 queE Because we are going to amplify a section of each of the upstream and downstream regions of these gene to create the inactivation vector (see Figure 1), we will need to design primers for each of these regions. In the workshop, we will design primers using the extracted sequence of the entire queG gene sequence plus including a further 1000 bp upstream and 1000 bp downstream (Figure 2). Figure 2. The queG (1173 bp) and associated UR and DR to be extracted”

a) Select the 1000 bp of the DR region and click on “Add Annotation”. At “Name” type in “1000 bp DR queG”. At “Type” retype as “DR”. Repeat for the Upstream region typing the “Name” as “1000 bp UR queG” and the “Type” as “UR”. Make sure the orientation of the UR and DR annotation is in the same direction as the gene. The exact size is important so take care to get this right. Click on the “1000 bp DR queG” annotation and holding down shift click on “1000 bp UR queG”. In this case the total size of sequence will be 1000 + 1173 +1000 bp=3173 bp (ie gene size + 2000 bp). b) In Geneious, extract this selected sequence (in this case 3173 bp). Label the extracted sequence “NGR_c36640 queG+_-1000bp”. Make a “WS 3 Primer Design” folder and drag and drop your extracted queG sequence into it. Check the orientation and make sure the coding strand of your gene is reading from left to right ie a Forward direction in Geneious (see workshop powerpoint presentation and Figure 2). In this case, you will need to reverse complement the extracted sequence so it is in the correct orientation. Make sure you save it as a separate file “NGR_c36640 queG+_-1000bp (Forward direction)”. c) Select 500 bp upstream of the queG start codon (do not include the start codon) and annotate the “Name” as “queG UR primer design excluded region” and rename the “Type” as “Primer excluded region”. Make sure the annotation is in the same direction as queG and that the size is 500 bp. d) Select 650 bp downstream of the queG stop codon (do not include the start codon) and annotate the “Name” as “queG DR primer design excluded region” and rename the “Type” as “Primer excluded region”. Make sure the annotation is in the same direction as queG and that the size is 650 bp. We will use these annotated regions for the design of primers. 3)

Select primer parameters for use in a Phusion PCR reaction.

Murdoch University

4

[BIO394 GENETIC ENGINEERING PCR AMPLIFICATION AND PRIMER DESIGN] WEEK 4 WORKSHOP 3 Before designing primers for PCR amplification of the upstream (UR) and downstream (DR) regions of queG, we first need to select the primer parameters that will be used in a Phusion PCR reaction (see workshop powerpoint presentation). For each primer pair (UR-F and UR-R; DR-F and DR-R) check the parameters that will be used (see workshop powerpoint presentation).

4)

Design primers for the upstream (UR-F and UR-R) and downstream regions (DR-F and DR-R) of the target gene. We will work through the process for the UR primer pair first. Click on the “queG UR primer design excluded region” 500 bp annotated region to select it. In the Geneious toolbar, click on “Primers”, then select “Design new primers”. In the dialogue box, select the correct parameters for ALL the dialogue boxes (Generic, Tm calculation, Characteristics) as per the primer parameters in the workshop powerpoint presentation. Make sure you have the correct parameters otherwise your primer design will be affected. Once all the parameters are put in, the primer design program Primer 3 in Geneious will calculate the optimal primers to be used for PCR amplification. You should have obtained the queG primers UR-F

CTATGTCGACGACAGCATGC (labelled NGR_c36640 UpF in excel assignment sheet)

UR-R

ACAGAGGTCGAAGCCCTTG (labelled NGR_c36640 UpR in excel assignment sheet)

Repeat the above process for primer design of the DR region using the “queG DR primer design excluded region” 650 bp annotated region. Fill in the details on the excel primer spreadsheet.

5)

Make sure the primers are unique a. Make sure the primers are unique in the genome of Rhizobium sp NGR234.

b.

To ensure that the primers are not able to randomly amplify another section in the NGR234 genome, use the Find function in Geneious to check that these primers are unique. You will need to search in all three of the NGR234 scaffolds. Make sure that the sequence of your putative PCR amplification product does not contain any sites for the restriction enzymes that we will be using for cloning of the fragment. ie for UR there should be no XhoI & SacI ie for DR there should be no HindIII & XbaI Murdoch University

5

[BIO394 GENETIC ENGINEERING PCR AMPLIFICATION AND PRIMER DESIGN] WEEK 4 WORKSHOP 3 Why is this important? 6)

Add appropriate tags. Select a primer annotation by clicking on it. Right click and select “Annotation” and then “Edit”. Click on “Extension”. Select “Bases” and enter “TAATAA”. Then select “Restriction site” and select the enzyme you need to use for your cloning (see primer spreadsheet and workshop powerpoint presentation).

7)

Extract out the amplification product sequences. Under “Primers” select “Extract PCR Product” and select “Extract all PCR products” and then click OK. Now determine the amplification product size. These sequences will be used to construct your inactivation vector for your laboratory project; to be done in the next Workshop. For NGR234_c36640, the queG Up PCR fragment will be 674 bp total (650 bp + 24 bp carrying the restriction sites and TAATAA tags on each end).

8)

Calculate the Tm for your primers (including restriction site and TAATAA tag) using the NEB Tm calculator (check that this is ~70° C; see primer spreadsheet and workshop powerpoint presentation for parameters). From the extracted PCR product file, copy and paste each primer sequence into the NEB Tm calculator. Record the Annealing temperature in the primer spreadsheet. Save your primer with the correct name in the spreadsheet (see the naming convention we have adopted in the primer spreadsheet).

NB: Check your amplification product sequences for restriction enzyme sites. Use XhoI and SacI for the UR amplification products. Check DR amplification products with HindIII and XbaI. You would only expect 2 sites for each amplification product; only 1 restriction site should be present on each end. If you have an extra restriction site in the primer you will have to modify the primer. To perform this change you will need to modify the excel assignment file and apply it to the Geneious primer annotation. 1) In the excel sheet, alter your primer sequence by deleting off the first base of the primer in column E labelled “Primer sequence 5’-3’ ”. 2) Recalculate the NEB Tm value for the altered primer sequence. 3) Change the Geneious primer annotation and extract the PCR product (check the size is 1 bp less). Establishing the amplification product size and enter into the excel assignment 2 sheet.

9)

Generate all of the primer pairs required for the target genes in your own time. Add this information to the Workshop 3 PCR Amplification excel file. The final completed table needs to be submitted COB Friday WEEK 6. This component will constitute 10% of your final mark.

Murdoch University

6...