FINAL 07 2020, questions and answers PDF

Preview

Summary

Module_4_ Ch_17.4-6...

Description

6/13/2020

Module #4: Ch 17.4-6

Module #4: Ch 17.4-6 Due: 11:59pm on Thursday, July 1, 2021 You will receive no credit for items you complete after the assignment is due. Grading Policy

Activity: Translation

Click here to complete this activity. Then answer the questions.

Part A Which of these is a tRNA?

ANSWER:

A B C D E

Correct This is a tRNA.

Part B What enzyme catalyzes the attachment of an amino acid to tRNA? ANSWER:

https://session.masteringbiology.com/myct/assignmentPrintView?assignmentID=8245843

1/10

6/13/2020

Module #4: Ch 17.4-6 aminoacyl-tRNA synthetase rubisco dextrinase argininosuccinate lyase nuclease

Correct This enzyme matches a particular tRNA with a particular amino acid.

Part C The tRNA anticodon, GAC, is complementary to the mRNA codon with the sequence _____. ANSWER: CAG CTG GAC CUG TCG

Correct In RNA uracil replaces thymine.

Part D What is the name of the process shown in the diagram?

ANSWER: initiation (of transcription) RNA processing initiation (of translation) elongation termination (of translation)

Correct The diagram illustrates the initiation of translation.

Part E The initiator tRNA attaches at the ribosome's _____ site.

https://session.masteringbiology.com/myct/assignmentPrintView?assignmentID=8245843

2/10

6/13/2020

Module #4: Ch 17.4-6

ANSWER: A translocation E P Q

Correct The initiator tRNA attaches to the ribosome's P site.

Point Mutations DNA polymerase is very accurate and rarely makes a mistake in DNA replication. Occasionally, however, an error in replication, known as a point mutation, is introduced. There are two general categories of point mutations—frameshift mutations (also called base-pair insertions or base-pair deletions) and base substitution mutations (shown in the diagram).

Part A - Base substitution mutations and frameshift mutations If a segment of DNA were replicated without any errors, the replicated strand would have the following sequence of nucleotides: 5' - ACTACGTGA - 3' Sort the following replicated DNA sequences by the type of point mutation each contains (frameshift, base substitution, or neither), as compared to the correc sequence shown above. Sort the items into the appropriate bins.

Hint 1. How to approach the problem In order to determine the type of point mutation contained in a DNA sequence, it is helpful to write the mutated sequences below the correct sequence so you can see the differences. The table below displays examples. Correct Sequence

ATGCAT

Substitution 1

ATCCAT

Substitution 2

ATGCTT

Frameshift 1

ATGGCAT

Frameshift 2

ATCAT

Frameshift mutations will change the number of nucleotides in a sequence; base substitution mutations will change the composition of the sequence but not the number of nucleotides.

Hint 2. How many bases are in each mutated segment? The correct DNA sequence contains nine bases. Which of the mutated sequences also contain(s) nine bases? Select all that apply. ANSWER:

https://session.masteringbiology.com/myct/assignmentPrintView?assignmentID=8245843

3/10

6/13/2020

Module #4: Ch 17.4-6 5' - ACTTACGTGA - 3' 5' - ACTCGTGA - 3' 5' - ACTAAGTGA - 3' 5' - ACTACGTGT - 3'

ANSWER:

Reset

5'-ACTTACGTGA-3'

5'-ACTCGTGA-3'

5'-ACTAAGTGA-3'

Help

5'-ACTACGTGT-3'

Correct A base substitution mutation can occur if the DNA polymerase inserts the wrong nucleotide base as it synthesizes a new strand of DNA. A frameshift mutation can occur if the DNA polymerase leaves out a nucleotide or adds an extra nucleotide to the sequence. Certain forms of cancer occur because of mutations in DNA sequences that are located in so-called mutational hotspots. These hotspots are locations in the DNA sequence where mutations occur more often than in other places.

Part B - Types of base substitution mutations When a base substitution mutation occurs, one nucleotide in a replicating DNA sequence is substituted for another, which results in the production of a mutan strand of DNA. The result of the mutation depends on how the substituted nucleotide base alters the string of amino acids coded by the mutant DNA. The three types of base substitution mutations are nonsense mutations, missense mutations, and silent mutations. Each type is defined by how it affects protein synthesis.

https://session.masteringbiology.com/myct/assignmentPrintView?assignmentID=8245843

4/10

6/13/2020

Module #4: Ch 17.4-6

Label the four mutated DNA segments shown below according to the type of point mutation each represents. Use the codon table above to determine how each mutation would affect the amino acid coding for each segment. Drag the labels to their appropriate locations to identify the type of point mutation shown.

Hint 1. How to approach the problem All base substitution mutations alter one base within the DNA sequence, causing a new base pair to form as the DNA replicates. This change in turn alters the mRNA sequence when the DNA is transcribed. The effect of this nucleotide substitution on the translation of the mRNA to a protein will depend on what amino acid is now coded for by the altered base sequence. There are three possible outcomes that can result: nonsense mutation: the new base changes an amino acid codon to a stop codon, ending protein synthesis and resulting in a shorter and usually nonfunctional protein. missense mutation: the new base leads to the insertion of a different amino acid than had been coded for, possibly altering the resulting protein’s structure. silent mutation: the new base does not change the amino acid sequence coded for by the original DNA strand. You will have to refer to the table of amino acid codons to predict which of the three possible outcomes will occur for each mutant DNA segment.

Hint 2. How do the three types of base substitution mutations differ? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. ANSWER:

Reset

Help

1. A nonsense mutation leads to early termination of protein synthesis.

2. Protein synthesis ends when a stop codon is produced. 3. A change in any triplet of bases in the mRNA sequence may or may not affect the coding of a(n) amino acid and change the structure of the synthesized protein.

4. A silent mutation results in the insertion of the same amino acid as was coded for by the original nucleotide sequence. 5. Base substitution mutations alter a(n) nucleotide in the original DNA sequence.

6. A missense mutation can dramatically alter protein structure because it results in the insertion of a different amino acid than was coded for by the original nucleotide sequence.

ANSWER:

https://session.masteringbiology.com/myct/assignmentPrintView?assignmentID=8245843

5/10

6/13/2020

Module #4: Ch 17.4-6 Reset

silent mutation

missense mutation

Help

nonsense mutation

frameshift mutation

Correct Point mutations in DNA sequences can profoundly affect protein synthesis, or they can have no effect at all. Point mutations can be beneficial to an organism but are more commonly neutral or harmful.

Part C - Severity of point mutations Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene?

Hint 1. How to approach the problem You know that each type of genetic mutation will affect the sequence of the gene, which will in turn affect the protein it codes for to varying extents. You need to consider how base substitution mutations typically affect proteins compared to how frameshift mutations typically affect proteins. Hint 2. Which mutation will affect an amino acid sequence the least? Of the mutations listed below, which one will likely change the amino acid sequence of the protein coded by the gene the least? ANSWER:

a base substitution at the beginning of the gene a base substitution at the end of the gene a frameshift deletion at the beginning of the gene a frameshift deletion at the end of the gene

ANSWER: a base substitution at the beginning of the gene a base substitution at the end of the gene a frameshift deletion at the beginning of the gene a frameshift deletion at the end of the gene

https://session.masteringbiology.com/myct/assignmentPrintView?assignmentID=8245843

6/10

6/13/2020

Module #4: Ch 17.4-6

Correct A frameshift mutation at the beginning of a gene would affect every codon after the point where the mutation occurred. During protein synthesis, incorrect amino acids would be inserted from the point where the frameshift mutation occurred on; the resulting protein would most probably be nonfunctional. For this reason, a frameshift mutation at the beginning of a gene is generally the most severe type of mutation.

Chapter 17 Pre-Lecture Question 7 Part A Which one of the following is true of tRNAs?

Hint 1. Consider what the "t" of tRNA represents.

ANSWER:

There are four types of tRNA. Each tRNA binds a particular amino acid. tRNAs are double-stranded. tRNAs carry special sequences known as codons. All of the above.

Correct Aminoacyl-tRNA synthetase joins a specific amino acid to a tRNA, a single strand of RNA about 80 nucleotides long.

Chapter 17 Pre-Lecture Question 8 Part A How is translation initiated?

Hint 1. Think through all of the steps.

ANSWER:

The small ribosomal subunit binds to the mRNA. The tRNA bearing methionine binds to the start codon. The large ribosomal subunit binds to the small one. The start codon signals the start of translation. All of the above.

Correct All of these processes occur at the initiation of translation.

Chapter 17 Pre-Lecture Question 9 https://session.masteringbiology.com/myct/assignmentPrintView?assignmentID=8245843

7/10

6/13/2020

Module #4: Ch 17.4-6

Part A What does a mutagen cause?

Hint 1. Consider the meaning of the prefix "muta-."

ANSWER:

a reduction in the number of tRNA molecules available for protein synthesis problems with mitosis decreased permeability of the nuclear envelope decreased enzyme activity throughout the cell a change in the sequence of DNA

Correct Mutations are changes in the genetic material of the cell.

Chapter 17 Pre-Lecture Question 10 Part A Which of these is currently considered the best definition of a gene?

Hint 1. How has our view of the gene evolved over the past century?

ANSWER:

A gene codes for a single enzyme. A gene codes for a particular ribozyme. A gene codes for a single polypeptide. A gene codes for either a polypeptide or an RNA molecule. A gene codes for a single protein.

Correct As our understanding of protein synthesis has expanded, we have seen that one gene may code for several polypeptides. We have also discovered many RNA molecules with diverse but important functions in the cell.

Chapter 17 Pre-Lecture Question 12

Part A Consider the following eukaryotic mRNA molecule: 5' - AUAACAUGGUGUGGUUGAAUGACAAGUAACCGCU - 3? What are, in order, the first and last two amino acids for the protein produced by this mRNA? Refer to The Codon Table for mRNA (Figure 17.5).

https://session.masteringbiology.com/myct/assignmentPrintView?assignmentID=8245843

8/10

6/13/2020

Module #4: Ch 17.4-6

Hint 1. When are codons read from mRNA?

ANSWER:

Iso-Thr...Asn-Arg Met-Thr...Asn-Arg Iso-Thr...Cys-Gly Met-Val...Lys-Stop Met-Val...Asp-Lys

Correct The mRNA molecule codes from the initiating AUG to the stop codon.

https://session.masteringbiology.com/myct/assignmentPrintView?assignmentID=8245843

9/10

6/13/2020

Module #4: Ch 17.4-6

Score Summary: Your score on this assignment is 98.7%. You received 18.75 out of a possible total of 19 points.

https://session.masteringbiology.com/myct/assignmentPrintView?assignmentID=8245843

10/10...