Genetics revision sheet PDF

Preview

Summary

Just a collection of notes. Books and website linked...

Description

Genetics revision sheet Meiosis   

Meiosis consists of two divisions, both of which follow the same stages as mitosis (prophase, metaphase, anaphase, telophase) Meiosis is preceded by interphase, in which DNA is replicated to produce chromosomes consisting of two sister chromatids A second growth phase called interkinesis may occur between meiosis I and II, however no DNA replication occurs in this stage

Meiosis I The first meiotic division is a reduction division (diploid → haploid) in which homologous chromosomes are separated  P-I: Chromosomes condense, nuclear membrane dissolves, homologous chromosomes form bivalents, crossing over occurs  M-I: Spindle fibres from opposing centrosomes connect to bivalents (at centromeres) and align them along the middle of the cell  A-I: Spindle fibres contract and split the bivalent, homologous chromosomes move to opposite poles of the cell  T-I: Chromosomes decondense, nuclear membrane may reform, cell divides (cytokinesis) to form two haploid daughter cells 

Meiosis II The second division separates sister chromatids (these chromatids may not be identical due to crossing over in prophase I)  P-II: Chromosomes condense, nuclear membrane dissolves, centrosomes move to opposite poles (perpendicular to before)  M-II: Spindle fibres from opposing centrosomes attach to chromosomes (at centromere) and align them along the cell equator  A-II: Spindle fibres contract and separate the sister chromatids, chromatids (now called chromosomes) move to opposite poles  T-II: Chromosomes decondense, nuclear membrane reforms, cells divide (cytokinesis) to form four haploid daughter cells  

The outcome of meiosis is the production of four haploid daughter cells These cells may all be genetically distinct if crossing over occurs in prophase I (causes recombination of sister chromatids)

https://ib.bioninja.com.au/standard-level/topic-3-genetics/33-meiosis/stages-of-meiosis.html

Non-Disjunction

 

Non-disjunction refers to the chromosomes failing to separate correctly, resulting in gametes with one extra, or one missing, chromosome (aneuploidy) The failure of chromosomes to separate may occur via: Failure of homologues to separate in Anaphase I (resulting in four affected daughter cells) Failure of sister chromatids to separate in Anaphase II (resulting in only two daughter cells being affected) Chromosomal Abnormalities If a zygote is formed from a gamete that has experienced a non-disjunction event, the resulting offspring will have extra or missing chromosomes in every cell of their body

    

Conditions that arise from non-disjunction events include: Patau’s Syndrome (trisomy 13) Edwards Syndrome (trisomy 18) Down Syndrome (trisomy 21) Klinefelter Syndrome (XXY) Turner’s Syndrome / Fragile X (monosomy X)



Down Syndrome Individuals with Down syndrome have three copies of chromosome 21 (trisomy 21) One of the parental gametes had two copies of chromosome 21 as a result of non-disjunction The other parental gamete was normal and had a single copy of chromosome 21 When the two gametes fused during fertilisation, the resulting zygote had three copies of chromosome 21



Studies show that the chances of non-disjunction increase as the age of the parents increase There is a particularly strong correlation between maternal age and the occurrence of non-disjunction events

 



This may be due to developing oocytes being arrested in prophase I until ovulation as part of the process of oogenesis https://ib.bioninja.com.au/standard-level/topic-3-genetics/33-meiosis/non-disjunction.html

Germline Germ line refers to the sex cells of an organism, it refers not just to mammals, but to any living organism that uses sex to reproduce, and that includes plants. And so, it is a rather generic term which refers to the cells in the sexual organ, and those cells will either be making sperm or eggs. And that sperm be could, of course, be pollen instead of what you traditionally think of as sperm. The key important aspect of germ line is this is where genetic information is transferred from one generation to the next. And it is inherited both from the female and the male of the species, so this is where all the action in terms of genetics is happening. And when those organisms grow up, they, of course, are not comprised primarily of germ cells. Most of the body is consisted of somatic cells. But the key issue in terms of evolution, in terms of inheritance, all go through the germ line.

Gametogenesis  

  

Gametogenesis is the process by which diploid precursor cells undergo meiotic division to become haploid gametes (sex cells) In males, this process is called spermatogenesis and produce spermatozoa (sperm) In females, this process is called oogenesis and produce ova (eggs) The process of gametogenesis occurs in the gonads and involves the following steps: Multiple mitotic divisions and cell growth of precursor germ cells Two meiotic divisions (meiosis I and II) to produce haploid daughter cells Differentiation of the haploid daughter cells to produce functional gametes

    

      

Spermatogenesis Spermatogenesis describes the production of spermatozoa (sperm) in the seminiferous tubules of the testes The process begins at puberty when the germline epithelium of the seminiferous tubules divides by mitosis These cells (spermatogonia) then undergo a period of cell growth, becoming spermatocytes The spermatocytes undergo two meiotic divisions to form four haploid daughter cells (spermatids) The spermatids then undertake a process of differentiation in order to become functional sperm cells (spermatozoa)

Oogenesis Oogenesis describes the production of female gametes (ova) within the ovaries (and, to a lesser extent, the oviduct) The process begins during foetal development, when many primordial cells are formed by mitosis (~40,000) These cells (oogonia) undergo cell growth until they are large enough to undergo meiosis (becoming primary oocytes) The primary oocytes begin meiosis but are arrested in prophase I when granulosa cells surround them to form follicles The primary oocytes remain arrested in prophase I until puberty, when a girl begins her menstrual cycle Each month, hormones (FSH) will trigger the continued division of some of the primary oocytes These cells will complete the first meiotic division to form two cells of unequal size

      

One cell retains the entirety of the cytoplasm to form a secondary oocyte, while the other cell forms a polar body The polar body remains trapped within the follicle until it eventually degenerates The secondary oocyte begins the second meiotic division but is arrested in metaphase II The secondary oocyte is released from the ovary (ovulation) and enters into the oviduct (or fallopian tube) The follicular cells surrounding the oocyte form a corona radiata and function to nourish the secondary oocyte If the oocyte is fertilised by a sperm, chemical changes will trigger the completion of meiosis II and the formation of another polar body (the first polar body may also undergo a second division to form a third polar body) Once meiosis II is complete the mature egg forms an ovum, before fusing its nucleus with the sperm nucleus to form a zygote

https://ib.bioninja.com.au/higher-level/topic-11-animal-physiology/114-sexual-reproduction/gametogenesis.html

The following phase is characterized by the formation of the morula, formed by many identical blastomeres. Subsequently, the blastomeres start to change and differentiate, under the control of specific transcription factors, namely CDX2 and EOMES (Fig. 1.6). This event is known as compaction and gives the embryo a smoother surface. In particular, the outer cells constitute the trophectoderm, or trophoblast cells,

that attach with neighbouring cells and form tight junctions and desmosomes. These specialized intercellular structures contribute to intercellular sealing and tissue integrity, critical for vectoral transport and blastocoele cavity formation.

Blastulation The following step is known as the blastulation phase, during which the trophoblast cells secrete a fluid into the central cavity, the blastocyst cavity or blastocoele, lining the cavity. This event transforms the embryo into a blastocyst and usually occurs during the first week of development. One pole of the blastocyst is occupied by the inner blastomeres, which give rise to the inner cell mass (ICM) and will form the embryo proper. In contrast, the other cells form the trophectoderm and will give rise to the embryonic placenta. The activity of a sodium pump located in the cell membranes of the trophoblast cells causes a blastocyst volume increase, drawing water into the central cavity. The blastocyst expansion may lead to rupture of the zona pellucida, which allows the blastocyst to escape through the opening. When this phenomenon does not occur, a blastocyst-secreted protease, known as strypsin, and proteolitic enzymes produced by the endometrium degrade and lyse the glycoproteins forming the zona pellucida. This process, known as hatching, enables the trophoblast cells to directly bind to the uterine cavity.

Inner cell mass (ICM) cell differentiation. At time of blastulation, ICM pluripotent cells differentiate into epiblast (NANOG-expressing cells) and hypoblast (GATA6-expressing cells) cells.

Comparison of pluripotent cell line derivation protocols for mouse and primate embryos. This image highlights the difference in timing of mouse and human development in vivo. It is important to note that the long period of culture that is required for the appearance of human embryonic stem cells would allow explanted cells to progress in vitro to the equivalent of the postimplantation mouse embryo, from which epiblast stem cells (EpiSCs) are derived.

Schematic representation of the development and derivatives of the ICM in mouse embryo. ICM of the murine embryo grows into the blastocyst cavity and forms the egg cylinder.

Brevini T.A.L., Gandolfi F. (2013) Early Embryo Development in Large Animals. In: Pluripotency in Domestic Animal Cells. SpringerBriefs in Stem Cells. Springer, New York, NY

DNA Sequencing: Sanger Method (Dideoxynucleotide chain termination) Sanger sequencing is a DNA sequencing method in which target DNA is denatured and annealed to an oligonucleotide primer, which is then extended by DNA polymerase using a mixture of deoxynucleotide triphosphates (normal dNTPs) and chain-terminating dideoxynucleotide triphosphates (ddNTPs). ddNTPs lack the 3’ OH group to which the next dNTP of the growing DNA chain is added. Without the 3’ OH, no more nucleotides can be added, and DNA polymerase falls off. The resulting newly synthesized DNA chains will be a mixture of lengths, depending on how long the chain was when a ddNTP was randomly incorporated.

Manual DNA sequencing example: • First, anneal the primer to the DNA template (must be single stranded): 5’ -GAATGTCCTTTCTCTAAG 3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5' • Then split the sample into four aliquots including the following nucleotides: "G" tube: All four dNTPs, one of which is radiolabeled, plus ddGTP (low concentration) "A" tube: All four dNTPs, one of which is radiolabeled, plus ddATP "T" tube: All four dNTPs, one of which is radiolabeled, plus ddTTP "C" tube: All four dNTPs, one of which is radiolabeled, plus ddCTP • When a DNA polymerase (e.g. Klenow fragment) is added to the tubes, the synthetic reaction proceeds until, by chance, a dideoxynucleotide is incorporated instead of a deoxynucleotide. This is a "chain termination" event, because there is a 3' H instead of a 3' OH group. Since the synthesized DNA is labeled (classically with 35S-dATP), the products can be detected and distinguished from the template. Note that the higher the concentration of the ddNTP in the reaction, the shorter the products will be, hence, you will get sequence CLOSER to your primer. With lower concentrations of ddNTP, chain termination will be less likely, and you will get longer products (sequence further AWAY from the primer). If, for example, we were to look only at the "G" reaction, there would be a mixture of the following products of synthesis: 5'-GAATGTCCTTTCTCTAAGTCCTAAG 3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5' 5'GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCG 3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5' 5'GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGG 3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5' 5'-

GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGGATG 3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5' 2 5'GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGGATGG 3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5' 5'GAATGTCCTTTCTCTAAGTCCTAAGTCCTCCGGATGGTACTTCTAG 3'-GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5' (and so on, if the DNA being sequenced continues to the right) Each newly synthesized strand at some point had a ddGTP incorporated instead of dGTP. Chain termination then occurred (no more polymerization). Because ddGTP incorporation is random, all possible lengths of DNA that end in G are produced. https://www.csus.edu/indiv/r/rogersa/bio181/seqsanger.pdf

Key points: 

Polymerase chain reaction, or PCR, is a technique to make many copies of a specific DNA region in vitro (in a test tube rather than an organism).



PCR relies on a thermostable DNA polymerase, Taq polymerase, and requires DNA primers designed specifically for the DNA region of interest.



In PCR, the reaction is repeatedly cycled through a series of temperature changes, which allow many copies of the target region to be produced.



PCR has many research and practical applications. It is routinely used in DNA cloning, medical diagnostics, and forensic analysis of DNA.

What is PCR?

Polymerase chain reaction (PCR) is a common laboratory technique used to make many copies (millions or billions!) of a particular region of DNA. This DNA region can be anything the experimenter is interested in. For example, it might be a gene whose function a researcher wants to understand, or a genetic marker used by forensic scientists to match crime scene DNA with suspects. Typically, the goal of PCR is to make enough of the target DNA region that it can be analyzed or used in some other way. For instance, DNA amplified by PCR may be sent for sequencing, visualized by gel electrophoresis, or cloned into a plasmid for further experiments. PCR is used in many areas of biology and medicine, including molecular biology research, medical diagnostics, and even some branches of ecology.

Taq polymerase Like DNA replication in an organism, PCR requires a DNA polymerase enzyme that makes new strands of DNA, using existing strands as templates. The DNA polymerase typically used in PCR is called Taq polymerase, after the heat-tolerant bacterium from which it was isolated (Thermus aquaticus).

T. aquaticus lives in hot springs and hydrothermal vents. Its DNA polymerase is very heat-stable and is most active around 70 °\text C70°C70, °, start text, C, end text (a temperature at which a human or E. coli DNA polymerase would be nonfunctional). This heat-stability makes Taq polymerase ideal for PCR. As we'll see, high temperature is used repeatedly in PCR to denature the template DNA, or separate its strands.

PCR primers Like other DNA polymerases, Taq polymerase can only make DNA if it's given a primer, a short sequence of nucleotides that provides a starting point for DNA synthesis. In a PCR reaction, the experimenter determines the region of DNA that will be copied, or amplified, by the primers she or he chooses. PCR primers are short pieces of single-stranded DNA, usually around 202020 nucleotides in length. Two primers are used in each PCR reaction, and they are designed so that they flank the target region (region that should be copied). That is, they are given sequences that will make them bind to opposite strands of the template DNA, just at the edges of the region to be copied. The primers bind to the template by complementary base pairing.

Template DNA: 5' TATCAGATCCATGGAGT...GAGTACTAGTCCTATGAGT 3' 3' ATAGTCTAGGTACCTCA...CTCATGATCAGGATACTCA 5' Primer 1: 5' CAGATCCATGG 3' Primer 2: When the primers are bound to the template, they can be extended by the polymerase, and the region that lies between them will get copied.

[More detailed diagram showing DNA and primer directionality]

The steps of PCR

The key ingredients of a PCR reaction are Taq polymerase, primers, template DNA, and nucleotides (DNA building blocks). The ingredients are assembled in a tube, along with cofactors needed by the enzyme, and are put through repeated cycles of heating and cooling that allow DNA to be synthesized. The basic steps are: 1.

Denaturation (96 °\text C96°C96, °, start text, C, end text): Heat the reaction strongly to separate, or denature, the DNA strands. This provides single-stranded template for the next step.

2.

Annealing (555555 - 656565°\text C°C°, start text, C, end text): Cool the reaction so the primers can bind to their complementary sequences on the single-stranded template DNA.

3.

Extension (72 °\text C72°C72, °, start text, C, end text): Raise the reaction temperatures so Taq polymerase extends the primers, synthesizing new strands of DNA.

This cycle repeats 252525 - 353535 times in a typical PCR reaction, which generally takes 222 - 444 hours, depending on the length of the DNA region being copied. If the reaction is efficient (works well), the target region can go from just one or a few copies to billions.

That’s because it’s not just the original DNA that’s used as a template each time. Instead, the new DNA that’s made in one round can serve as a template in the next round of DNA synthesis. There are many copies of the primers and many molecules of Taq polymerase floating around in the reaction, so the number of DNA molecules can roughly double in each round of cycling. This pattern of exponential growth is shown in the image below.

Using gel electrophoresis to visualize the results of PCR The results of a PCR reaction are usually visualized (made visible) using gel electrophoresis. Gel electrophoresis is a technique in which fragments of DNA are pulled through a gel matrix by an

electric current, and it separates DNA fragments according to size. A standard, or DNA ladder, is typically included so that the size of the fragments in the PCR sample can be determined. DNA fragments of the same length form a "band" on the gel, which can be seen by eye if the gel is stained with a DNA-binding dye. For example, a PCR reaction producing a 400400400 base pair (bp) fragment would look like this on a gel:

Left lane: DNA ladder with 100, 200, 300, 400, 500 bp bands. Right lane: result of PCR reaction, a band at 400 bp. A DNA band contains many, many copies of the target DNA region, not just one or a few copies. Because DNA is microscopic, lots of copies of it must be present before we can see it by eye. This

is a big part of why PCR is an important tool: it produces enough copies of a DNA sequence that we can see or manipulate that region of DNA.

Applications of PCR Using PCR, a DNA sequence can be amplified millions or billions of times, producing enough DNA copies to be analyzed using other techniques. For instance, the DNA may be visualized by gel electrophoresis, sent for sequencing, or digested with restriction enzymes and cloned into a plasmid. PCR is used in many research labs, and it also has practical applications in forensics, genetic testing, and diagnostics. For instance, PCR is used to amplify ge...