Module 7 Questions PDF

Preview

Summary

End of module exercise 7...

Description

Introduction to Biochemistry and Molecu lar Biology Molecular BCMB 3100E

End of module assignment Summer 2020

Molecular Biology End of Module Assig Assignment nment

Honor Statement: This assignment adheres to the standards of UGA’s Culture of Honesty policy. The answers to these questions are my own words and all external sources (besides your textbook, group, professor and PLAs) have been cited. (You do not need to use proper citation formatting, just copy and paste the link.) Take ake-Home -Home Poi Point nt Much in the same way that various biomolecules can store and transfer chemical energy, they can also carry and transmit the information that governs life. Elaborate biochemical machinery maintains and conserves genetic material through generations of a population, while genetic mutations can alter chemical information.

Learning Objective Objectivess 1. Describe and draw the chemical structures of nucleic acids. 2. Recognize nucleosides, nucleotides, ribose, deoxyribose, purines, pyrimidines. (All Gods Are Pure--adenine and guanine are purines) 3. Compare and contrast RNA vs DNA in terms of their chemical structure. 4. Describe the non-covalent interactions that contribute to the formation and stability of a DNA double helix. 5. Have a general understanding of the processes of transcription and translation. 6. Transcribe DNA sequences and translate mRNA sequences. 7. Apply knowledge of the central dogma to genetic mutations. 8. Describe various types of DNA mutations. 9. Explore consequences of a mutation in the enzyme methylmalonyl CoA and possible treatments for methylmalonic acidemia (MMA). 10. Understand generally how human MUT mRNA was prepared and delivered to the liver of mouse to to treat MMA and the results of Figure 5B. 11. Explain how the following techniques work, including advantages, limitations, controversies: mRNA therapy, and CRISPR.

Pa Part rt I – Structural Basics 1. Draw a nucleotide of your choosing (can be from RNA or DNA). Label the components of the molecule and also indicate which parts of the molecule make up a nucleoside.

Updated by Sarah Robinson (Summer 2019).

Pa Part rt III – The Central Do Dogma gma and Genetic Mutations 2.

The DNA sequence below is for part of the gene sequence (bp 1876-1917) that encodes methylmalonyl-CoA mutase (MUT), the subject of the discussion post for the last module. Answer the following questions based on this coding strand of DNA:

5’ GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’ a. Write the template DNA sequence (other DNA strand). Write it 3’ to 5’ 3’ CCGGTACTGTCTCCTCGTTTTCAATAACGA 5’ b. Write the mRNA sequence that would be transcribed. Write it 5’ to 3’. 5’ GGCCAUGACAGAGGAGCAAAAGUUAUUGCU 3’ c. Write the amino acid sequence that would be translated from mRNA sequence. The reading frame is already set, so the first three nucleotides are the first codon. Designate the N-terminus and the Cterminus of this polypeptide. (N-terminus) glycine histidine asparagine arginine glycine alanine lysine valine isoleucine alanine (C-terminus)

d. Drennan et al. (1996) identified several mutations in this enzyme that result in methylmalonic acidemia (MMA). One of those mutations is a C to A at base pair 1904 in the coding strand of DNA (marked in teal in the template strand).

Write the amino acid sequence for this patient, highlight in yellow what differs from the normal (wildtype) sequence). Explain your work (this would include showing the mRNA sequence, which will help in giving feedback if there is an error).

glycine histidine asparagine arginine glycine glutamine lysine valine isoleucine alanine The mRNA sequence for this polypeptide is 5’ GGCCAUGACAGAGGAGAAAAAGUUAUUGC 3’ The C to A mutation at base pair 1904 causes the wildtype codon GCA that codes for alanine to become GAA, which is translated as glutamine. e. What type of mutation is this? (insertion, deletion, silent, nonsense, missense, or frameshift mutation) Explain your reasoning. This is a missense mutation because the single base pair substitution calls for the translation of a different amino acid, altering protein function.

Pa Part rt IV – Disease Applications 3.

Moderna, Inc. (https://www.modernatx.com) is a biotech company that is in the beginnings of phase 1/2 clinical trials for a new therapeutic for methylmalonic acidemia (MMA) called mRNA 3704. Go to the company’s webpage to look at their focus and why they are using mRNA technology. What is their rationale for using an mRNA as at treatment for MMA?

Moderna has developed the technology to synthesize mRNA that cells recognize and can translate into proteins. These proteins enable the body to fight or prevent disease. The company employs this technology because other drug approaches are not able to direct protein production. This allows for the treatment of diseases that are not addressable otherwise. mRNA as a treatment for MMA is expected to provide instructions to hepatic cells to synthesize methylmalonyl CoA mutase (MUT) protein. By increasing MUT protein levels, levels of the harmful substances in the blood of MMA patients that cause symptoms, such as methylmalonic acid, are expected to decrease. The use of enzyme replacement therapy is not available for MMA, which is one of the reasons why mRNA therapy is potentially a breakthrough in MMA treatment. https://www.oaanews.org/mrna-clinical-trial-for-mma-mut-phase-12.html

4.

mRNA3704 has already been tested in mice. Use this link to the paper and read the abstract, introduction and figure 1 (https://www.cell.com/cell-reports/comments/S2211-1247(17)31748-5) a. Read the Methods Section entitled “mRNA production and formulation”. How was the mRNA modified: what was added and what was the purpose of each modification? The mRNA of mRNA3704 was modified by incorporating 5’ and 3’ UTRS, including a poly-A tail. Adding the 5’ cap provides a recognition signal for ribosome binding during translation and protects the mRNA from degradation. The addition of a poly-A tail stabilizes the mRNA strand. Also, a donor methyl group from Sadenosylmethionine was added to methylated capped RNA. This was to increase mRNA translation efficiency. b. How is mRNA3704 administered? mRNA3704 is administered intravenously. In this study, the mRNA was injected into the tail vein of the mice. c.

What organ is the mRNA targeted for and what is used to target it to that organ?

mRNA3704 targets hepatocytes in the liver. It is encapsulated by biodegradable lipid nanoparticles (LNP) for delivery. Once LNP enter the liver, they are metabolized and the mRNA is released. d. In what organelle does the MUT enzyme function? MUT functions in the mitochondria.

5.

The researchers generated a MMA mouse model (Mut -/-) and injected them with human mRNA3704 (hMUT). Three days later they sacrificed the mice and measured their MUT protein levels. Below is figure 6A from the paper, which shows that the mice receiving the injection do produce MUT protein.

Below is figure 5B from the paper, a survival curve of the mice with and without treatment with mRNA3704. Mice were injected each week with either control mRNA or hMUT mRNA (mRNA3704), for 5 weeks. Compare the hMUT mRNA mice to both controls.

The mice injected with hMUT mRNA had a much higher rate of survival than both the mice treated with the control mRNA and the untreated mice. The control group had a 30% chance or lower chance of survival over 5 weeks, while all of the mice left untreated died by week 3 of the experiment.

6.

Now you have learned about 2 ways that MMA could be treated: mRNA therapy, and CRISPR. Suppose you are a genetic counselor helping a family decide how to help their baby who has MMA. To help the parents decide, create a list of pros and cons for each treatment. mRNA therapy Pros:  Provides a treatment option for mitochondrial enzymopathies, which cannot be treated by enzyme replacement therapy. mRNA therapy is more effective than AAV-mediated gene therapy, because the body develops neutralizing antibodies to the vector, making re-dosing less effective.  Does not transit to the nucleus, diminishing the risk of insertional mutagenesis  Can restore “unreachable” targets like transmembrane and intracellular proteins  More safe, effective, and enables more specific B- and T-cell responses than traditional vaccines  Short half-life allows for the controlled expression of the encoded antigen  Its ability to be produced by in vitro transcription allows for quick and cost-effective development  Functions in both mitotic and non-mitotic cells, unlike plasmid DNA Cons:  mRNA is intrinsically unstable and prone to degradation by nucleases, so it must be chemically modified (though this has been achieved by modifying the poly-A tail, 5’ cap, and UTRs)  mRNA therapy bypasses the stringent gene-therapy regulations in the U.S., causing some concerns over safety  Large molecular weight and high negative charge density of mRNA hinder its intracellular delivery. Therefore, delivery systems are required  mRNA is highly immunogenic, which limits its in vivo application

file:///Users/carolinejones/Desktop/pharmaceutics-12-00102-v2.pdf https://www.labiotech.eu/in-depth/rna-review-rnai-mrna/

CRISPR Pros:  It is relatively easy to change the target genomic region once the CRSIPR-Cas9 system has been established  Relatively inexpensive  Can not only correct disease-causing mutations but may modify human characteristics, like bone strength or height  High level of specificity  Can address needs not met by other methods of avoiding genetically inherited diseases. Some examples are when two prospective parents are homozygous for a disease-causing variant or in the case of polygenic disorders. Cons:     

Possibility of off-target modifications, which create mutations somewhere other than the target region of the genome. This could cause other diseases or otherwise harmful consequences. Susceptible to immune reactions Various ethical concerns, including the idea of embryonic consent and that animals who were genetically engineered for human consumptions would have a reduced quality of life Engineering of human traits to an extreme could lead to a new type of classism, where humans are defined by their genetic modifications. This technology would only be available to the wealthy. There are many unknowns about its effect in humans, as federal and NIH funds cannot be used for gene editing in human embryos

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3795411/pdf/nihms444192.pdf

https://www.genome.gov/about-genomics/policy-issues/Genome-Editing/ethical-concerns

7.

Thinking about this module as a whole, what concept(s) did you find the most difficult? What are you still unclear about? The most difficult part of the module for me was interpreting the paper on mRNA3704. The technical language made it difficult to get through, though I eventually found the answers to the module questions. Everything else I felt pretty confident about! What work will you do to clarify it? N/A Any suggestions for improvement of this module? None...