PAST EXAM February 2017 PDF

Preview

Summary

Download PAST EXAM February 2017 PDF

Description

PRIFYSGOL BANGOR BANGOR UNIVERSITY

BANGOR

Arholiadau Diwedd Semester 2 End of Semester 2 Examination

2016/17 2016/17

Amser a ganiateir: Time allowed:

2 awr 2 hours

DNS-1003 Ecology & Evolution MULTIPLE CHOICE QUESTIONS On the separate multiple choice answer sheet: 1

Using a dark pencil or pen, on the appropriate lines at the head of the form, please write the module code, your student ID, your user name and your name in the four boxes available.

2

Then, affix your barcode label (supplied) to the top right-hand side of the form. Do not obscure the boxes on the left-hand side of the form.

Using a a dark pencil or pen, please mark your chosen answers on the multiple choice answer sheet, by placing a cross, in the appropriate boxes (numbered 1 to 60), one per question (a, b, c or d). If you don’t know the answer to a question, please place a cross in the appropriate box in column e. If you make a mistake, strike out the incorrect answer and completely fill the box. A correct answer will score +5; An incorrect answer will score -1; A blank answer (option e, “don’t know”) will score 0. N.B. Your total score will never be lower than zero.

1. Which of the following statements is NOT CORRECT? a. Ecology is the scientific study of the distribution and abundance of organisms, and the interactions that determine distribution and abundance b. Ecology only relates to the biotic components of ecosystems c. Ecology is the scientific study of the relationship between organisms and their environments d. Ecology helps understand where organisms are found, how many occur there, and why e. Don’t know

2. There are many levels of integration in ecology. At which level is it presumed we have the least scientific understanding? a. b. c. d. e.

Landscape ecology Physiological ecology Population ecology Behavioural ecology Don’t know

3. The change in the genetic composition of populations between generations is: a. b. c. d. e.

Macroevolution Microevolution Natural Selection Speciation Don’t know

4. The process by which new species are formed from pre-existing species over a long period of time is: a. b. c. d. e.

Speciation Microevolution Macroevolution Genetic drift Don't know

5. In humans, the heritability of MN blood type is 1 (one) and the heritability of second language is 0 (zero). This means that: a. MN blood type is determined entirely by environment and second language is determined entirely by genotype b. MN blood type is determined entirely by genotype and second language is determined entirely by environment c. there is only one MN blood type, but many second languages d. there are many MN blood types, but only one second language e. Don't know 6. Which of the following statements is CORRECT about DNA (deoxyribonucleic acid)? a. It undergoes semi-conservative replication b. It changes (mutates) when mutations are needed to improve survival, growth and reproduction c. It is composed entirely of genes d. It was discovered by Gregor Mendel e. Don't know

7. Humans (species Homo sapiens) are thought to: a. b. c. d. e.

be most closely related to chimpanzees and bonobos have characteristics that mean the species will never go extinct have evolved in Europe have no natural resistance to HIV (human immunodeficiency virus) Don't know

8. Shell colour in the snail Cepaea nemoralis is under genetic control. Snails with yellow shells are more common on sand dunes; against the light-coloured sand they are much less visible than snails with brown shells, and are less likely to be eaten by predatory birds. Snails with brown shells are more common in woodlands where the ground surface is darker; against this background snails with yellow shells are very visible and are more likely to be eaten by predatory birds. This is an example of: a. b. c. d. e.

blending inheritance mutation natural selection speciation Don't know

9. The low reproductive success and very low genetic diversity of cheetahs (Acinonyx jubatus) are thought to be the result of: a. b. c. d. e.

a population crash in the 19th and 20th centuries from overhunting a population crash 10,000 years ago from unknown causes intense natural selection caused by competition for food intense natural selection caused by competition for mates Don't know

10. Which of the following statements about the fossil record is correct? a. b. c. d. e.

all life appeared on planet Earth at the same time evolution always proceeds gradually (phyletic gradualism) evolution always proceeds in bursts (punctuated equilibrium) life is old and has changed over time Don't know

11. What type of selection is this?

a. b. c. d. e.

Disruptive Stabilising Directional Artificial Don't know

12. The mechanisms of change responsible for both microevolution and macroevolution are: a. b. c. d. e.

extinction, mutation, natural selection and speciation extinction, genetic drift, mutation and natural selection genetic drift, migration, mutation and natural selection genetic drift, mutation, natural selection and speciation Don't know

13. Which of the following is CORRECT? A monophyletic group is a group that contains a. b. c. d.

All the descendants of a common ancestor, and only its descendants Some but not all the descendants of a common ancestor The descendants of a common ancestor that are similar to that ancestor The descendants of a common ancestor that do not have any unique derived character states e. Don’t know

14. Which of the following is CORRECT? The monophyly of a group of organisms can be inferred from: a. b. c. d. e.

Their overall similarity The possession of shared derived character states The possession of shared primitive character states The absence of unique derived character states Don’t know

15. Which of the following statements is NOT true? a. Shared derived character states can be identified through outgroup comparison. b. Shared derived character states are also known as synapomorphies.. c. Shared derived character states can be identified because they are more common than primitive character states. d. Shared derived character states imply monophyly of the organisms that have them. e. Don’t know 16.

Consider the following data:

Vomer

Dipnorhynchus (fossil lungfish, OUTGROUP) large

Australian lungfish large

South American lungfish small

African lungfish small

Which of the following statements is INCORRECT? a. The African and South American lungfish are a monophyletic group b. A small vomer is a shared derived character state of the African and South American lungfish c. A small vomer is a synapomorphy of the African and South American lungfish d. A large vomer is a shared derived character state of the Australian lungfish and Dipnorhynchus e. Don’t know

17. Consider the following data

Skull bone sutures

Dipnorhynchus (fossil lungfish, OUTGROUP) straight

Australian lungfish

South American lungfish

African lungfish

wavy

straight

straight

Which of the following statements is CORRECT? a. Straight skull bone sutures are a synapomorphy of African and South American lungfish b. Straight skull bone sutures support the monophyly of African and South American lungfish c. Wavy skull bone sutures are a primitive character state d. This character tells us nothing about the phylogeny of lungfish e. Don’t know

18. Consider the following data and the tree given thereafter:

Skull bone sutures Vomer

Dipnorhynchus (fossil lungfish, OUTGROUP) straight

Australian lungfish

African lungfish

wavy

South American lungfish straight

large

large

small

small

straight

Dipnorhynchus Australian lungfish African lungfish South American lungfish

How many instances of character change does this tree force us to assume? a. b. c. d. e.

0. 1. 2. 3. Don’t know

19. Which of the following is an INCORRECT statement about the Biological Species Concept? a. b. c. d. e.

The Biological Species Concept is inapplicable to asexual organisms The Biological Species Concept is inapplicable to fossils organisms The Biological Species Concept is difficult to apply in plants The Biological Species Concept is the only widely accepted species concept Don’t know

20. Which of the following is CORRECT?

In cladistic taxonomy, organisms are classified on the basis of a. b. c. d. e.

Similarity in a key character Genetic similarity A combination of similarity and monophyly Monophyly Don’t know

21. Consider the following DNA sequence data for an outgroup (A) and four species (B, C, D and E). A B C D E

(outgroup)

acggccctcctcctaggcttaagtttggactat acggtcctcctcctaggcttaagtttggactat acggttctcttcctaggcttaagttcggactat acggttctcttcctgggcttaagttcggattat acggttctcttcctgggcttaagttcggattat

Which of the following trees is the most parsimonious? Tree 1

Tree 2

E

D

D

C

C

B

B

E

A

A

Tree 3

a. b. c. d. e.

Tree 4 D

E

C

D

E

C

B

B

A

A

Tree 1 Tree 2 Tree 3 Tree 4 Don’t know

22. Which of the following statements is INCORRECT? DNA sequence data a. Often allow the absolute time of divergence between lineages to be calculated. b. Often provide more numerous characters for analysis than morphology. c. Reflect differing environmental conditions during embryonic development. d. Are usually unaffected by natural selection for different ecological conditions. e. Don’t know

23. Which of the following traditions of behavioural research largely focussed on laboratory studies of learning in rats and pigeons as models for human beings? a. b. c. d. e.

Evolutionary psychology Ethology Sociobiology Behaviourism Don’t know

24. An ultimate (as opposed to a proximate) question relating to group living in animals is: a. What are the fitness benefits of living in groups? b. How does the environment in which an animal develops influence its social behaviour? c. How do hormonal levels influence social behaviour? d. What are the sensory mechanisms require for living in social groups? e. Don’t know 25. An ethogram is: a. b. c. d. e.

A series of descriptions/diagrams of behavioural categories A piece of equipment for recording behaviour A person who studies animal behaviour A graphic showing statistical relationships between kinds of behaviour Don’t know

26. It is believed that guppies living in downstream pools show stronger schooling behaviour than those living upstream because: a. b. c. d. e.

Water flows are slower Predation risk is higher Food is more plentiful They are less colourful Don’t know

27. An example of an experimental approach to animal behaviour studies is: a. The comparison of weaver bird social structures in forest and savannah habitats b. The comparison of guppy shoaling behaviour in upstream and downstream pools c. The comparison of female cichlid fish mate preferences under white and coloured light d. The comparison of African ungulate group sizes in relation to antipredator defences e. Don’t know

28. Which of the following is an example of imprinting? a. A dog learns to salivate in response to a bell which has been rung whenever food is presented b. A pigeon learns not to peck at the green button when it produces an electric shock c. A fish learns not to attack its mirror image d. A young gosling learns to follow a human who cares for it e. Don’t know 29. Which of the following statements about monogamous pairing is INCORRECT? a. b. c. d. e.

It is common among mammals Sexes tend to look similar It is often associated with parental care by both parents It is rare in the animal kingdom Don’t know

30. There are three colour forms of male side-blotched lizards, each associated with a different kind of mating behaviour. Which theoretical approach is used to understand how these can all co-exist? a. b. c. d. e.

Sexual selection theory Statistical theory Habituation theory Evolutionary game theory Don’t know

31. Which of the following statements about three-spined sticklebacks is FALSE? a. Males compete to attract females to lay their eggs in nests built of pieces of vegetation glued together by secretions from their kidneys b. Males attack unrealistic dummies with red undersides, rather than realistic models that lack red c. Females prefer to mate with brighter red males, probably because the intensity of the red colour is influenced by a male’s health d. Females were able to avoid males that had recently been sick, even when the intensity of the red colour was obscured under monochromatic light e. Don’t know 32. Which of the following statements about sexual selection is FALSE? a. b. c. d.

In mate choice, females tend to be the choosier sex Maternal care tends to reduce the number of females available for mating Males are always larger and stronger than females Competition between males can sometimes prevent females choosing their mates e. Don’t know

33. In a population that exhibits density dependent growth, what happens to the per capita growth rate with increasing population density? a. b. c. d. e.

Capita growth rate increases Capita growth rate stays equal Capita growth rate decreases Capita growth rate goes up then down Don’t know

34. In a population where the population size is higher than carrying capacity K: a. b. c. d. e.

The numbers dying and the number of births are equal Numbers dying are higher than the number of births Numbers dying are lower than the number of births It is impossible to know if the numbers dying or the number of births is higher Don’t know

35. When two species are competing, how large is the realized niche relative to the fundamental niche? a. b. c. d. e.

The realized niche is larger than the fundamental niche The realized niche and fundamental niche are the same size The fundamental niche is larger than the realized niche It is impossible to know which one is larger Don’t know

36 If the population of a species is facilitated by another species, how large is the realized niche relative to the fundamental niche? a. b. c. d. e.

The realized niche is larger than the fundamental niche The realized niche and fundamental niche are the same size The fundamental niche is larger than the realized niche It is impossible to know which one is larger Don’t know

37. A sea lamprey is a: a. b. c. d. e.

Predator Grazer Parasite Parasitoid Don’t know

38. What effect will an increase in killer whale predation on sea otters have on kelp? a. b. c. d. e.

Kelp will increase in abundance Kelp will decrease in abundance Kelp abundance will stay equal, and plants will be of equal size Kelp abundance will stay equal, but kelp plants will be larger Don’t know

39. Which of these is not an interaction from which at least one party benefits? a. b. c. d. e.

Parasitism Mutualism Commensalism Amensalism Don’t know

40. Which of the choices below are all iteroparous species? a. b. c. d. e.

Dragonfly, salmon, plaice, human Dragonfly, salmon, june beetle, maize Plaice, human, elephant, sea turtle Plaice, june beetle, elephant, sea turtle Don’t know

41. According to life history theory, what will happen to great tit clutch size when abundance of sparrow hawks increases? a. b. c. d. e.

Clutch size will increase Clutch size will stay equal Clutch size will decrease and egg size will decrease Clutch size will decrease and egg size stay equal Don’t know

42. When is it most beneficial for elephant seals to delay primiparity? a. b. c. d. e.

When juvenile survival is low and adult survival is low When juvenile survival is low and adult survival is high When juvenile survival is high and adult survival is low When juvenile survival is high and adult survival is high Don’t know

43. Starting with a climax community, which of the following correctly describes how community diversity alters as the frequency of disturbance increases: a. b. c. d.

Community diversity remains constant initially and then very quickly decreases Community diversity increases Community diversity decreases Community diversity increases, reaches a maximum and then decreases to a minimum e. Don’t know 44. Which of the following is NOT an example of a natural disturbance agent? a. b. c. d. e.

Feeding pits created by gray whales Periodic forest fires Bison trampling on prairies Fishing disturbance on the seabed Don’t know

45. Which of the following statements is true in relation to body size/abundance relationships? a. b. c. d. e.

Body size increases linearly with decreasing abundance Log body size increases linearly with decreasing abundance Log body size increases linearly with decreasing log abundance Body size decreases linearly with increasing abundance Don’t know

46. Which of the following would occupy the highest trophic level in a marine foodweb? a. b. c. d. e.

Phytoplankton Crab Bivalve mollusc Seal Don’t know

47. Which of the following would occupy the highest trophic level in a terrestrial foodweb? a. b. c. d. e.

Grass Grizzly bear Cricket Jackal Don’t know

48. Which of the following statements is CORRECT? a. Marine pelagic systems are highly size structured due to the constraints of mouth gape b. Terrestrial systems are more highly size-structured than marine systems c. The majority of marine biota are able to process prey larger than themselves d. Cannibalism is rare in marine systems e. Don’t know 49. Which of the following statements is NOT CORRECT? a. Marine species can occupy several trophic levels throughout their life-history b. Depletion of a species at one trophic level will always have knock-on effects for species at lower and higher trophic levels c. Marine foodwebs are complex with many species occupying the same trophic level d. There is considerable redundancy in marine systems due to diffuse predation e. Don’t know

50. Complete the following sentence. Maximum sustainable yield is a concept that describes: a. The amount of flexibility in a marine ecosystem b. The greatest amount of a natural resource that can be removed/harvested without jeopardising the future of that resource c. The surplus production in a marine system d. The additional biomass gained as a result of harvesting e. Don’t know 51. Which of the following best describes a sustainable fishery? a. A fishery that generates the most profits for fishers b. A fishery that sets precautionary total allowable catches, and that minimises secondary ecosystem effects including the environmental effects of food miles c. A fishery that sets precautionary total allowable catches, and that minimises secondary ecosystem effects and sells products for the best price d. A fishery that is based entirely on small fishing vessels e. Don’t know 52. Which of the following statements is NOT CORRECT? a. Bivalve cultivation is one of the most sustainable forms of aquaculture because they feed at low trophic levels b. Cultivation of predatory fish creates secondary environmental problems du...