Dna mutant - yellow gene investigation in drosophila melanogaster PDF

Preview

Summary

yellow gene investigation in drosophila melanogaster...

Description

Yellow body color in Drosophila melanogaster caused by a start codon mutation in the Yellow gene Anna Beatriz Machado Lab partners: Emily Hummel, Shohil Patel and Gerardo Rubio PCB3063L 903

Introduction Drosophila. Melanogaster is one of the most vastly used model organisms in biomedical sciences. It’s an organism easy to study, that allows for vast use of molecular tools to investigate it. It provides for fast reproduction time, which facilitates the study of genetic inheritance. This fruit fly also possesses many genes that are homologous to genes of other species, therefore giving key information about other species developments and ununderstood pathways (Tolwinski, 2017). Pigmentation in animals is known to have come through evolution, but it is still not widely understood as to how and where in the organism it happens. The study of pigmentation and melanin can be further researched with the use of Drosophila melanogaster as a model species by studying how pigmentation is synthesized, and where in the DNA the mutation happens that cause the differences in pigmentation found within the species. The most common phenotype of Drosophila melanogaster found in nature is the wildtype phenotype. Such phenotype has tan body color, but mutations in the flies’ DNA can cause them to show other body colors such as yellow. This research has the purpose of connecting genotype and phenotype through molecular analysis by finding what DNA mutations are responsible for the mutant yellow body color phenotype in yellow flies. This question will be answered by comparing the DNA of yellow mutant flies with the DNA of wildtype flies as a control group by using DNA sequencing, in order to locate where in the DNA sequence this mutation occurs. This difference in phenotype between wildtype and yellow type D. melanogaster is due to a yellow protein present in the fly’s DNA. Whenever there is a functional yellow protein, a tan body phenotype is obtained, due to the protein synthesizing black melanin. This is what causes the phenotype in wildtype flies. Whenever this yellow gene is not functional, it causes the gene to not produce yellow protein, and therefore be unable to synthesize black melanin, causing the

yellow phenotype. To further understand how yellow protein produces black melanin and how this yellow phenotype is obtained, the biochemical pathway needs to be studied first. In invertebrates, especially in insects, melanin is formed during cuticle development. This happens because a system of Phenol Oxidases processes dopa and dopamine, this in return generates the formation of melanin and the difference in production of pigments (Wittkopp, et al., 2002). What seems to be indicative of the cause of this mutation though, is that yellow protein is seen anywhere with black pigments; the higher the amount of yellow protein present, the more black pigment is present in the fly (Wittkopp, et al., 2002). This paves the focus when studying yellow phenotype, as it points to a mutation in the yellow gene causing a lack of phenol oxidase, therefore inhibiting black melanin synthesis in yellow D. melanogaster phenotype. Knowing that the yellow body phenotype is obtained from a lack of yellow protein, it is hypothesized that when analyzing the mutant fly’s DNA and comparing it with the control group, the wildtype fly’s DNA, it will be possible to see where in the protein sequence the mutation happens. The wildtype flies will have a sequence fragment that is either not present or differs than in the yellow fly’s DNA sequence. Knowing where this difference happens will lead to finding what is different in the yellow fly’s DNA that changes their phenotype. In order to test the hypothesis, many different techniques were used in this experiment, such as PCR amplification and DNA sequencing. Methods The following procedures were adapted from the CMMB lab manual from Fall, 2019 (CMMB, 19). Genomic DNA extraction

To amplify the regions of interest in the flies’ genome, the genomic DNA from both the mutant and wildtype flies needed to be isolated, to then be looked at by gel electrophoresis. To isolate the gDNA of both groups of flies, the flies were first anesthetized and separated by phenotype. Phenol extraction was then performed on the flies to remove proteins from the nucleic acids and extract DNA. The sample was then put through centrifugation to separate the different layers containing nucleic acids, proteins and lipids, and upon centrifugation, the top layer containing only DNA + RNA solution was transferred to new tubes containing RNase. RNase was used to remove RNA from the sample, as DNA was the only nucleic acid needed for this experiment. The DNA samples were then loaded onto the agarose gel, and gel electrophoresis results obtained. PCR amplification of gDNA To amplify regions of interest in the flies’ genome, primer sequences such as the ones seen in table 1 were added to the DNA samples, in order to bind in the gene loci and allow for analysis. Primer set 1 binds to the coding region of exon 1, while primer 2 and 3 bind to the overlapping regions in exon 2. A master mix was made containing the 1:20 gDNA samples, primers and 5X Taq polymerase. Another mix was made containing the same ingredients, but water instead of the DNA samples. The master mix was then transferred to 3 different PCR tubes, one of them containing molecular grade H2O to serve as a control, one containing mutant type gDNA and another one containing wildtype gDNA. The control with H2O served the purpose of showing that there was no contamination of other nucleotides in the samples. These samples were then put in a thermal cycler so the target DNA sequence could be amplified, the thermal cycler sequence is presented in table 2. Samples were then visualized through gel electrophoresis.

Table 1. Primer set 1, 2 and 3 with their forwards and reverse sequence

Primer set 1 Primer set 2 Primer set 3

Forward sequence 5' GCCGACATATTATGGCCACC 3' 5' GTTTGGCCCTGCTAATTCTCC 3' 5' GATGGTTATCGTACCCTGTAC 3'

Reverse sequence 5' CAATGCCATGCTATTGGCTTC 3’ 5' GTCGATGACTTGCTAACGGAC 3‘ 5' ACCCAAGTACCGTGTGTAGG 3'

Table 2. Thermal Cycler cycle for PCR amplification

Temperature 95 

Thermal Cycler Time 2 minutes

95  55 

30 seconds 30 seconds

72 

2 minutes

Repeat steps 2-4 38 times, making a total of 39 cycles of step 2-4 4 hold

Function Initial denaturation of Template DNA denaturation Annealing of primer to template Extension of DNA sequence from the primer Keeps product cold until transferred to freezer at -20 C 

Gel Electrophoresis The use of agarose gel electrophoresis allows for the analysis of different DNA fragments in the flies’ DNA. This relies on different sizes of DNA running at different speeds through the gel, with smaller fragments moving faster down the gel towards the positive side, as DNA is negatively charged. Gel electrophoresis was utilized to test the samples for DNA and to visualize the PCR products. The solution with the master mix and different gDNA, as well as the H2O control group were loaded into the gel. The 1% agarose gel was ran for 40 minutes at 120 volts. This allowed to see the different DNA fragments and therefore locate if the mutation was large enough to see a difference in size of fragments and in the location in the DNA ladder.

DNA ligation To study the expression of the yellow gene, a molecular cloning of D. melanogaster was made using the plasmid vector pCR4-TOPO, a small self-replicating circle of DNA that allows for the bacteria in it to be grown infinitely. This vector contains restriction enzymes such as DNA Topoisomerase I that allow the DNA to unwind and better replicate, as well as EcoR I, a restriction enzyme that contains ampicillin resistance, or anti-biotic resistance. The plasmid is then collected and introduced to E. Coli host which self-replicates. The replication clones are put in an ampicillin containing agar medium. This ensures that all the new clone cells created contain the DNA plasmid, otherwise they would not be able to form colonies. This allowed for a larger amount of PCR product to be present and therefore increasing sample size. This was done by setting up 3 ligation reactions containing water, PCR products (one ligation for wildtype, one for mutant type and a no insert as control), a salt buffer and the vector, followed by incubation at room temperature. Miniprep of plasmid DNA This procedure is done to isolate the plasmid DNA from cultures and quantify it. This was done by centrifuging the liquid culture from the plasmid DNA and using a neutral buffer with RNase to resuspend the cells. This is followed by an alkaline lysis that releases the DNA from the replicated E. coli cells, resulting in an extract of proteins, bacterial genomic DNA and plasmid DNA in small amounts. Acidic potassium acetate was then used to neutralize the lysis reaction, which after centrifugation and being applied to an affinity column resulted in plasmid DNA free from protein and genomic DNA contamination Quantification of Plasmid DNA

To quantify how much nucleic acids and their purity in the sample, the sample was put through the NanoDrop spectrophotometer. A process that emits UV light, which DNA and RNA absorb. This process indicated the DNA concentration, if there were any contaminants such as undesired proteins, phenol or salts in the samples, and helped determine which plasmid DNA samples were best to use for restriction digest and sequencing. Restriction analysis of Plasmid DNA Restriction digest analysis was used to verify that the plasmid DNA contained the right inserted PCR product. This was done by mixing DNA samples, water and the restriction enzyme EcoR I, which cut the insert at the 5’-GAATTC-3’ sequence. The reaction was then incubated and loaded onto the gel electrophoresis using 1.5% gel ran for 70 minutes at 100 volts. An uncut plasmid was used as control to ensure only the specified PCR product replicated. DNA sequencing DNA sequencing was used to determine the exact genetic code and order of nucleotides in the yellow gene fragments of the fly’s DNA. This was done by using the samples with the purest DNA and adding a sequencing mix, so the samples could then be loaded onto a thermal cycler with the sequence presented in table 3. This provided the sequencing reaction. For this sequence to be read by the sequencing machine, the products were purified removing excess dye. Once the DNA sequence was obtained, NCBI Nucleotide and Protein BLAST/ExPasy were used to compare the mutant and the wildtype fly’s nucleotide and protein sequence. This experiment’s wildtype sequence was also compared with the databases’ wildtype D. melanogaster sequence to ensure it was correct. The differences in their sequencing were then compared. To ensure the mutation found was reliable, a chromatogram was used to indicate the confidence score in that

nucleotide change. This chromatogram works by using color coded fragments that attach to each dideoxy nucleotide, proving a specific DNA sequence with a different peak per fragment. When the peaks are well separated and do not overlap, there’s certainty on the specific nucleotide in that sequence. Table 3. Thermal Cycler program for DNA sequencing

Temperature 96  96  50 

Thermal Cycler Time 1 minute 20 seconds 20 seconds

60 

4 minutes

Repeat since step 1 29 times, making a total of 30 cycles 4 hold

Function Initial denaturation Denaturation Annealing of primer to template Extension of DNA sequence from the primer Keeps product cold until transferred to freezer at -20 C 

Results There were many steps done in this experiment to reach a conclusion as to what causes the mutation in the yellow body phenotype from the wildtype phenotype. The first attempt involved DNA isolation, which was put through gel electrophoresis. The result of this gel can be seen in figure 1, where it’s possible to see that bands did not show well on the gel, but confirmed that the samples contained DNA nonetheless. To amplify the specific gene, PCR amplification was done, and the products were visualized through gel electrophoresis. The results of the gel can be seen in figure 2, which show all the same bands for the mutant and wildtype’s DNA. In order to isolate and purify the DNA even further, a miniprep of plasmid DNA was done. This

plasmid DNA was then quantified for purity and concentration. The results can be seen in table 4. The wildtype using primer 2 tested for A 260/280 of 1.76 and 1.8 and a concentration of 32.8ng/ul and 31.1ng/ul. The mutant type using primer set 2 tested for A 260/280 of 1.8 and 1.78 and a concentration of 55ng/ul and 63.1ng/ul. After being quantified, the plasmids with best DNA purity and concentration were put through restriction digestion. This was again visualized through gel electrophoresis and the results can be seen in figure 3, where the wildtype and mutant band fragments are the same value in the DNA ladder throughout all matching primers. Finally, DNA sequencing was used in order to compare the nucleotide and protein sequence in the flies using BLAST. First, the experiment’s wildtype DNA sequence was put on protein BLAST and compared with the data base’s wildtype protein sequence. The results of this can be seen in figure 4, where both the top and bottom strand completely match each other, and there was a 94% identity. After the wildtype sequences were compared, the protein sequence of the mutant and database’s wildtype flies was compared using BLAST. The results of this can be seen in figure 5, where it’s noticeable that from the beginning the proteins don’t match, showing that there was a mutation in the very beginning. To ensure the results were right, a chromatogram was used for both the mutant and the wildtype sequence. These chromatograms can be seen in figure 6. These chromatograms show that there is a high confidence scores in the peaks. Furthermore, this experiment led to the conclusion seen in the graphic summary in figure 7 that the mutation in the start codon from ATG to CTG in the mutant fly leads to no yellow protein synthesized and therefore a yellow color phenotype in the mutant fly.

Figure 1. Agarose gel electrophoresis of gDNA This figure shows the agarose gel electrophoresis analysis using the isolated genomic DNA. The bands show that there was DNA in the samples, but the samples were not the cleanest as no actual fragments showed.

Figure 2. PCR amplification visualized through gel electrophoresis. This figure shows the amplified PCR product of both the wildtype and the mutant type, as well as a H2O control. It can be seen that the band fragments are the same for both phenotypes, leading to the conclusion that the mutation is not large enough to be seen using only this method. The H2O control shows that there was no contamination in the samples, as no bands appeared for H2O

Table 4. Quantification of plasmid DNA Sample name/ #

A260/A280

WT #2 MUT #2 MUT #2 WT #2

1.76 1.8 1.78 1.8

Concentration of DNA sample (ng/ul) 38.2 55 63.1 31.2

Figure 3. Restriction Digest gel electrophoresis analysis. 1.5% gel ran for 70 minutes at 100 volts This gel electrophoresis shows the plasmid DNA results after being cut with EcoRI for both mutant and wildtype, as well as an uncut control group. This analysis shows that mutant and wildtype produce the same band fragments for each primer set, again showing that the gene mutation is not large enough to be seen through this type of analysis. The uncut group only showed a fragment at 4k bp, which represents the plasmid it was grown in

Figure 4. Protein BLAST comparison between database’s wildtype and the experiment’s wildtype fly. This BLAST comparison shows that there was a 94% identity between the two, with the top and bottom strand completely matching one another, proving that the database’s wildtype fly is significantly the same as the experiment’s wildtype.

Figure 5. Protein BLAST sequence comparison between database’s wildtype and mutant fly. In this BLAST comparison the wildtype and mutant fly highly divert from each other, having identity percentages as low as 26% between the two. This shows that there is a mutation in the protein early on in the gene, and shows that this must be the causing mutation.

Figure 6. DNA sequencing chromatogram. This image shows exactly where in the gene these flies differ. The wildtype fly has a regular start codon ATG, while the mutant fly has a mutation that changes the A (Adenine) for C (Cytosine), and therefore without the start codon, the protein can never

Primer Set 1 (886 bp)

Primer set 3 (875 bp)

WT

1

Encodes for

2

YELLOW PROTEIN

Primer set 2 (621 bp)

ATG start codon

Primer Set 1 (886 bp)

Stop codon

Primer set 3 (875 bp)

MUT

1

NO

2

YELLOW PROTEIN

Primer set 2 (621 bp) ATG

CTG

Stop codon

Figure 7. Graphic summary of the coding regions for the yellow allele This summary shows how the start codon in the wildtype flies allows for yellow protein to be synthesized. When there is a replacement from A to C in the mutant fly, the start codon does not work and therefore does not allow for yellow protein to be synthesized

Discussion There were a multitude of different experiment’s and analysis to find out what causes the phenotypic change in yellow flies from wildtype flies. To start testing the hypothesis that it would be possible to see the gene mutation by studying their DNA, agarose gel electrophoresis. First the DNA was extracted and then put through the gel. The gel did not yield any conclusive results, as seen in figure 1, where there were large smears across the gel, but no band fragments. The smears showed that there was DNA in the samples, but that the samples were not the best quality. Nonetheless, the samples allowed for PCR amplification, where 3 different primers were used, each focusing on a particular number of base pairs in the gene. Once DNA was successfully replicated using this method, a gel electrophoresis analysis was done which can be seen in figure 2. This did not show any conclusive results to the experiment, as the wildtype and mutant fly’s DNA fragments matched perfectly on the DNA ladder for each primer set, meaning that the mutation was not large enough to be seen through this type of analysis. Furthermore, the use of H2O as a control showed that the samples were not contaminated, as there were no fragments in the H2O samples. Otherwise, contamination could have created fragments on the samples being studied, yielding false results. Plasmid DNA miniprep was then used. Once enough DNA molecules had grown in culture, this plasmid was put through a nanodrop spectrophotometer that quantified the DNA for purity and indicated the concentration of it. The results can be seen in table 4. A 260/280 ratio of

1.8 or greater indicates that the sample is pure. The A 260/280 ratio indicated that the samples were pure and there was no contamination of either proteins, phenol, salts or other contaminants in the sample. A restriction digest was done, leading to the results in figure 3. In this electrophoresis analysis, the same thing happened as in the previous PCR amplification gel electrophoresis. The wildtype and mutant type showed the same band fragments in the DNA ladder for each specific primer, demonstrating again that this mutation was not big enough to be seen using this method. In the negative side for each primer its possible to see that there is a band at 4k bp, this represents the uncut plasmid, and serves as a control to ensure only the specified PCR product replicated. Finally, the DNA sequence in the flies was looked at. To ensure the results were right so far...