Worksheet 8 - Transcription PDF

Preview

Summary

Transcription...

Description

Worksheet 8 Transcription Learning Objective. The activity below will help you understand the structures and processes of transcription. (10 points) Evaluation. The worksheet will be graded as: Needs improvement Answers are missing or mostly incorrect.

Fair All answers are present, but many are incorrect.

0-5 points

Drawings instead of models can earn a max of 7/10 if everything else is perfect. 6-7 points

Good Answers are mostly correct but superficial.

Exceptional Answers are 100% accurate, thorough, and creative.

8-9 points

10 points

Instructions. Answer the questions below. When you’re finished, upload your assignment into Blackboard as a .docx or .pdf (no .pages because I can’t view those). Part 1. Model the process of transcription. 1. Describe how your models will represent the different cellular structures and features involved in transcription in Table 1. 2. Provide a photo of the individual structures and features listed in Table 1. a. Drawings: i. Can be done instead of models but can only earn a max of 7/10 if everything else is perfect. ii. Can be done in many different ways (examples: using the features in Word or PowerPoints, using the Paint app on your computer and drawing with your mouse or touchpad, taking a picture of a hand-drawing and pasting that into the box below, or using a stylus/touch screen to draw in the structures. Pasted images taken from online will not be accepted.

Table 1. Structures  features

Describe how its represented in your models below in Table 2.

Photos of the individual structures and features

WS-Transcription, BIOS 208, Dr. Bergan-Roller, Fall 2020

1

Transcription factors

(example: golf balls)

DNA 

Pencils

5’ and 3’ ends  Double strand sections  Single strand sections  Base pairs  Promoter section RNA polymerase

Nucleotide triphosphates (NTPs)

Shoe string

Lead cases

2 WS-Transcription, BIOS 208, Dr. Bergan-Roller, Spring 2021 Online

RNA   

Lead 5’ and 3’ ends Specific bases Single stranded

3. In Table 2: a. List and order the three phases of transcription in the first column. b. In the second column, use the descriptions given below (copy and paste these) to list the steps of transcription in the order that they happen. RNA polymerase RNA RNA RNA RNA Transcription begins reading the polymerase polymerase polymerase polymerase factors bind DNA template in the binds continues to is removed unwinds a promoter read DNA from DNA section of the 3’5’ direction and promoter incorporates a few template and leaving the DNA, complementary add original DNA separating complementary and a new the base pairs NTPs into a new RNA strand, growing in NTPs in the mRNA strand from opposite the 5’3’ direction 5’3’ direction strands c. Create models of each of these steps with items you have around your house. Be sure to include the items and features listed in Table 1. i. Again, drawings can be done instead of models but can only earn a max of 7/10 if everything else is perfect. ii. Here is an example of a fair transcription stop motion video of a model: https://www.youtube.com/watch?v=5u3IxUduOCk

Table 2 Phase

Description

Picture of model

3 WS-Transcription, BIOS 208, Dr. Bergan-Roller, Spring 2021 Online

A. RNA polymerase begins reading the DNA template in the 3’5’ direction and incorporates a few complementary NTPs into a new RNA strand, growing in the 5’3’ direction B. RNA polymerase binds promoter

Elongation

Initiation

C. RNA polymerase continues to read DNA template and add complementary NTPs in the 5’3’ direction

D. RNA polymerase is removed from DNA leaving the original DNA and a new mRNA strand E. RNA polymerase unwinds a section of the DNA, separating the base pairs from opposite strands

4 WS-Transcription, BIOS 208, Dr. Bergan-Roller, Spring 2021 Online

Termination

F. Transcription factors bind promoter

Part 2. Transcribe a DNA sequence into mRNA 4. Below is a DNA sequence with specific portions (promoter and intron) annotated. The bottom strand is the template for transcription. Promoter intron

5’– CGTATATATGGTAATATGTACCCAGAGGAAATGAGTAGGA – 3’ 3’– GCATATATACCATTATACATGGGTCTCC TTTA CTCAT CCT-5’

a. Act as RNA polymerase to transcribe the bottom strand. Write out the resulting RNA sequence below. The first base that should be transcribed (read) is the bolded A in the promoter on the bottom template strand.

5’– AAAGUAGAUUGUAUACCUGGUAGG

– 3’

b. In the circles above your RNA strand, label the ends with the functional groups that appear there (hydroxyl group or phosphate group). Part 3. RNA processing 5. Now you will be modifying your mRNA strand (above) based on the processing that occurs in eukaryotic cells before the RNA leaves the nucleus. a. To represent the intron being spliced out of the RNA, remove the complementary RNA sequence designated as “intron” in the original DNA template. b. To represent the 5’ cap, write “G-P-P-P” at the 5’ end. c. To represent the poly-A tail, write “AAAAAAA” at the 3’ end. d. In the space below, re-write your processed RNA sequence with these three modifications.

5’ CGTATATATGGTAATATGTACCCAGAGGGAGTAGGA-AAAAAAA 3’ 3’ GCATATATACCATTATACATGGGTCTCCCTCATCCTG-PPP 5’ 5 WS-Transcription, BIOS 208, Dr. Bergan-Roller, Spring 2021 Online

Academic Integrity Statement I have completed this assignment with academic integrity, as defined in the syllabus and according to NIU policy (https://www.niu.edu/academic-integrity/index.shtml), including creating my own novel work and not sharing my work with others to reuse in the future. All participation in scholarly discussions and brainstorming of ideas with peers were done in an ethical manner, enabling creative thought without jeopardizing academic integrity. A missing signature will result in a score of 0.

Z ID

6 WS-Transcription, BIOS 208, Dr. Bergan-Roller, Spring 2021 Online...