BIOC 448L 9 DNA Primers 2018-09-12 PDF

Preview

Summary

This assignment we had to use NCBI to get our DNA primer for our mutant enzyme. ...

Description

Biochemical Methods BIOC 448L

Fall 2018

DNA Primers Homework 3

Introduction The overall goal of this laboratory is to learn how we utilize bacterial cells as factories to produce protein (such as malate dehydrogenase), through expressing the DNA encoding this protein in bacteria. We will also learn about antibiotic resistance and gene expression. The specific objectives of this activity are to: 1. Characterize the plasmid DNA. 2. Generate evidence that the plasmid contains an insert with the appropriate watermelon glyoxysomal malate dehydrogenase (wgMDH) gene sequence. During this lab period, you will design DNA primers for sequencing the wgMDH gene inserts. DNA Structure and Gene Expre Expression ssion The structure of DNA is critical to the mechanisms of gene expression. The four nitrogenous bases of DNA are arranged along the sugar-phosphate backbone, encoding all genetic instructions for an organism. Adenine (A) pairs with thymine (T), while cytosine (C) pairs with guanine (G). The two DNA strands are held together by hydrogen bonds between the bases. Hydrogen bonds are relatively weak but are essential to both DNA replication by DNA polymerases and transcript transcription ion by RNA polymerases. These hydrogen bonds can be temporarily disrupted, and the DNA double helix unwound by cellular enzymes to make the template for either the new DNA strand during replication or messenger RNA (mRNA) synthesis during transcription. A gene is a unit comprised of sequence that contains the information necessary for transcription into mRNA and the translation of the mRNA sequence into protein by cytoplasmic ribosomes. Recomb Recombinant inant DNA The field of molecular biology grew from the ability to manipulate genetic information using recombinant DNA technology. Recombinant DNA (rDNA) is DNA from two different sources that have been recombined so that a gene of interest can be studied. Recombinant DNA allows researchers to clone individual genes so they can study both their structure and function separate from the organism from which they were originally isolated. The term cloning has many different meanings depending on the context in which it is used. Molecular biologists use the term to describe the process of creating recombinant DNA molecules. Insulin was the first commercially available, genetically engineered product that was a direct result of expressing a foreign protein in bacteria. Since then, many products have been created using this technology, including some cancer-fighting drugs such as interferon. frame ame ame) of interest to the The term insert describes the segment of DNA (typically a single gene or open reading fr researcher that encodes a protein. To clone the DNA and express it in bacteria you must first put it into a carrier molecule called a vector vector.. A vector is a piece of DNA that can be used to carry foreign DNA into host cells. A vector, by definition, replicates autonomously (i.e., separately from chromosomal DNA) and can therefore be used as a cloning vehicle for carrying newly-created recombinant DNA molecules. Once the foreign DNA is inserted into a vector, it is transferred to a host cell. The vector with the foreign DNA is replicated, producing clones that can be isolated and analyzed. Common vectors used in molecular biology are plasmids and phages. We will deal only with plasmids in this laboratory. Of course, recombinant DNA technology would not be possible without restriction endonucleases that cut the DNA phosphate backbone at specific DNA sequences. Another important enzyme is DNA ligase that catalyzes the resealing of the DNA backbone once it has been cut. Once the foreign DNA or insert has been ligated or cloned into a vector, it is transferred to a host cell line via a process referred to as tran transformation. sformation. The host cell then replicates, producing identical offspring as well as replicating the vector (including the foreign gene). This leads to a huge amplification of the cloned DNA because most bacteria divide every 20 minutes under optimal conditions. Next, you need to be able to find the very small proportion of bacterial cells that actually were transformed. This process is called selection. The vector will have some type of marker gene that allows identification of bacterial cells that took up the vector. Common selectable markers ©

Malate dehydrogenase CUREs Community (MCC) 1

are genes encoding enzymes that confer resistance to antibiotics. Selection depends on the expression of the antibiotic resistance gene. Restrictio Restriction n Enzymes Restriction endonucleases cleave double stranded DNA at a site in very specific palindromic sequences (usually 4, 6, or 8 bp recognition sequences). These enzymes are produced naturally by bacteria (likely as a defense mechanism to digest foreign DNA) and play a critical role in molecular cloning. As the sequence recognized by a restriction enzyme is cut in a specific way, and because DNA structure and composition are essentially universal, DNA from one source (e.g., a gene/cDNA from plants) can be sub-cloned into another source (like a yeast expression plasmid). The restriction enzyme generates compatible ends in each fragment; these ends can specifically bind to each other and join the two DNA fragments through base pairing.

Important information about working with enzymes: Enzymes are very expensive and must be used correctly. Generally, they are provided in special buffers with glycerol for long term storage. They lose activity quickly once they are at room temperature and are generally not active at all unless buffered. Always keep enzymes in the freezer or on ice. Never vortex an enzyme; this results in denaturation. Always add enzymes last unless directed otherwise and use a new, sterile pipette tip (just as you would with any solution). Cross-contamination can and will occur very easily.

Plasmids A plasmid must have several features in order to be used as a vector for cloning. For the plasmid to be replicated independently of the host genome, it must have its own origin of replication (ori ). A plasmid must have a selectable marker, such as gene that confers resistance to an antibiotic. The presence of a selectable marker allows for growth of Escherichia coli in the presence of an antibiotic, thus allowing selection of cells that contain the plasmid. The plasmid must also have many unique restriction sites for use when inserting the foreign piece of DNA into the plasmid. These unique sites are often concentrated on a region of high restriction site density called a polylinker or multiple cloning site (MCS) (MCS). The pQE-60 plasmid, commercially developed by Qiagen, is shown in Figure 1. It has one selectable marker, which is the gene for ampicillin resistance. It also encodes a 6xHis tag (…-His-His-His-His-His-His) at the C-terminus of the protein for purification purposes after expression.

Figure 1: Map of the pQE-60 Plasmid (abridged from Qiagen). Gray regions indicate features with

2

extended sequences. White and colored boxes indicate specific codons or residues. This plasmid was used to create vectors that express the wgMDH gene. The gene was inserted using the NcoI and BamHI restriction endonuclease sites. Site-directed mutagenesis subsequently produced plasmids that contain mutated DNA sequences within the wgMDH gene. All the plasmids are summarized in Table 1. Table 1 – Plasmid Library Plasmid pQE-60 pQE-wgMDH pQE-wgMDH pQE-wgMDH pQE-wgMDH pQE-wgMDH

K125R N137D N162E R196A

Description

Size (kb)

Empty plasmid (no insert) Plasmid with watermelon glyoxysomal MDH wild-type gene insert Plasmid with watermelon glyoxysomal MDH K125R gene insert Plasmid with watermelon glyoxysomal MDH N137D gene insert Plasmid with watermelon glyoxysomal MDH N162E gene insert Plasmid with watermelon glyoxysomal MDH R196A gene insert

3.4 4.6 4.6 4.6 4.6 4.6

The complete map of pQE-60 is available at: https://www.qiagen.com/us/resources/resourcedetail?id=95410277-affb-4f89-a6cd-228c2036320e&lang=en The sequence of pQE-60 is available at: https://www.qiagen.com/us/resources/resourcedetail?id=b5e8c7ab-be1f-422a-a746-c5bc2808a03f&lang=en Nucleotide accession # wgMDH: M33148 (wild-type)

Characterization DNA Char acterization 1. (4 pts) Look up specific details about the two restriction enzymes used with the pQE-60 plasmid to produce the wild-type wgMDH plasmid. A trusted supplier is New England Biolabs; their web address is https://www.neb.com/. Show the ends that are created by each enzyme. An example is given using EcoRI. EcoRI 5’…G 3’…CTTAA

AATTC…3’ G…5’

NcoI

5’C 3’GGTAC

CATGG3’ C5’

BamHI

5’C 3’CCTAG

GATCC3’ G5’

2. (10 pts) Create a visual representation, either hand-drawn or digital, to show the vector that contains the mutant wgMDH gene you selected. (If you are quick with web-based tools, there are many vector mapping tools online that will output images.) In addition to the features shown in Figure 1, label the wgMDH gene and the mutation. The gene should be indicated by a thick arrow, similar to the ampicillin resistance gene. Hint: Just like a restriction enzyme, you will need to “cut” the plasmid open. Therefore, think about the features in the zoomed-in region as separate pieces rather than one region.

3

Title: Wild-type pQE-60 plasmid Legend: Complete map of pQE-60

Title: Mutant wgMDH N162E Legend: First image is drawn plasmid with mutation N162E using NcoI and BamHI. Second image shows computer-generated plasmid with drawn in mutation site. Third image is same exact thing as first with origin of replication. Please look at all three pictures to get full image of plasmid.

4

5

Software NCBI Primer-BL Primer-BLAST AST https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi This web-based tool will generate options for primers that you will then need to evaluate. Important data entry fields include:  Sequence – This is the MDH insert. The most efficient way to enter the sequence is to use the accession number for watermelon glyoxysomal MDH, since you already have that information in Homework 1.

6

 Primer Range – Primers are usually around 20 bp long. Choose a forward primer upstream of your mutation and a reverse primer downstream of your mutation. The maximum distance allowed between “Forward primer From” and ”Reverse primer To” is 250 bp. Click on the help icon for more information.  # of primers to return – This is the number of forward and reverse pairs that will be generated. Leave it set to the default of 10 for your first run, to see how long it takes to process your query. It will take longer to generate a higher number of pairs.  Show results in a new window – Recommended.  Use new graphic view – Nice feature; highly recommended. Allow several minutes for your primers to be generated. The page will update automatically and display the results.

Primer Design 3. (6 pts) Use NCBI’s Primer-BLAST tool to generate ten pairs of potential primers that would amplify about 100 bp (i.e., about 50 bp on both sides) around your mutation. Note and/or take a screen shot of the entries you made. You may need to do both if, for instance, you enter an entire DNA sequence instead of an accession number. The entire sequence would not be documented in a screen shot, so you would include the entire sequence either above or below the screen shot.

7

4. (6 pts) In the graphical view, under Tools, go to Markers to add a tag that will mark the location of your mutation. It will be similar to the “Template” tag. Download a pdf of the output.

8

5. (6 pts) What happens when you click on Sequence Text View, under Tools? Document the output. It will become very handy later. When I click on “Sequence Text View” under Tools a pop-up window of the nucleotides sequence shows up. On this pop up, I can see my mutation I selection in green at 555 and I can also see my primer range with red brackets. 6. Use the detailed reports to evaluate the proposed primers. Is the mutation near the end of the primer? How does the Tm of each primer influence your decision? GC content? Self-complementarity? If you are uncertain, research these parameters using trustworthy sources and document the information. a. (6 pts) Document the detailed reports.

9

(10 pts) Complete the table below. For each primer pair, note the characteristics that make the pair desirable and/or undesirable to use. Rank the primer pairs, with #1 being your top choice and #10 being your last choice. NCBI Primer Pair 1

Desirable Characteristics

Undesirable Characteristics

Far enough away from our mutation.

2

Good location

3

Good location

4

Tm’s are close to each other. Reverse primer self 3’ complementarity is 0. Tm’s very close to each other. GC content is exactly the same for both reverse and forward. Tm’s very close to each other. GC content is exactly the same for both reverse and forward. Tm’s very close to each other. GC content is exactly the same for both reverse and forward. Good location

5

6

7

8

10

Forward and reverse primers are different lengths. Tm could be closer to each other. Also, self-complementarity for forward primer is high. Self 3’ complementarity is 1 higher for reverse primer when compared to primer pair 1. Tm difference too far apart. Self 3’ complementarity is 1 higher for reverse primer when compared to primer pair 2. Tm difference too far apart. Other self/self 3’ complementarities are still a tad high. Self/self 3’ complementarities too high except for reverse self 3’ complementarity Self/self 3’ complementarities too high

Self/self 3’ complementarities too high. Reverse self 3’ complementarity is one less than primer pair 6. Reverse primer 22 bp long (a tad too

Ran k 6

7

8

4 1

3

2

9

9

long). Self/self 3’ complementarities too high. GC content and Tm’s not as close as others. Reverse primer 22 bp long (a tad too long). GC content not close. Tm’s not close.

GC content the same for both. Tm’s are close. Good location.

10

5

b. If meaningful improvements could be made to your top two choices, repeat the steps above to do so. I don’t see any obvious and most importantly meaningful improvements that can be made to our top two choices (pairs 5 and 7). Insert your notes and/or screen shot of your entries. Insert the graphical view of your primer options. Insert documentation of the Sequence Text View output. Insert documentation of the detailed reports. NCBI Primer Pair 1 2 3 4 5 6 7 8 9 10 7.

Desirable Characteristics

Undesirable Characteristics

response response response response response response response response response response

response response response response response response response response response response

Ran k X X X X X X X X X X

(2 pts) Complete the information below. Your top primer pair will be ordered for you, using these sequences. Please double-check them. Lab Day (W/R/F)

Team # (1-8)

R

2

Mutant (e.g., K125R) N162E

Forward (5’) primer sequence, written 5’  3’: CTGCAGGTGTTCCTCGAAAA Reverse (3’) primer sequence, written 5’  3’: TGCCACAAAGGTATTGGCTC

11...